Overexpression of Multiple Detoxification Genes in Deltamethrin Resistant Laodelphax striatellus (Hemiptera: Delphacidae) in China

Abstract

BackgroundThe small brown planthopper (SBPH), Laodelphax striatellus (Fallén), is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH.Methodology/Principal FindingsDeltamethrin resistant strains of SBPH (JH-del) were derived from a field population by continuously selections (up to 30 generations) in the laboratory, while a susceptible strain (JHS) was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold) in JH-del strains (G4 and G30) when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3–IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. Conclusion/SignificanceAs the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to enhanced detoxification rather than target insensitivity. The findings lay a solid ground for further resistance mechanism elucidation studies.

Under-Expression of Chemosensory Genes in Domiciliary Bugs of the Chagas Disease Vector Triatoma brasiliensis

“…We found DE genes involved in the insecticide resistance process, including genes encoding cytochrome P450s, gluthatione S-transferases and cuticle proteins. Accordingly, several studies of cytochrome P450s have revealed over-expression in field populations of insects that are resistant to insecticide [103–108]. Cytochrome P450 genes are involved in detoxification.…”

Biochemical and molecular characterisation and cross‐resistance in field and laboratory chlorpyrifos‐resistant strains of Laodelphax striatellus (Hemiptera: Delphacidae) from eastern China

“…The transcriptome of L. striatellus was sequenced and annotated as described previously . Gene tags corresponding to P450s, ESTs and GSTs were identified and subjected to BlastX search against the NCBI protein database.…”

“…Expression levels of genes, including 71 P450, 39 carboxylesterase, 54 phosphoesterase and 12 GST genes, were determined by PCR as described by Xu et al Briefly, semi‐quantitative RT‐PCR was first carried out for those genes with elevated expression in resistant hoppers, based on microarrays. Total RNA samples from the JHS and the JH‐chl strains were reverse transcribed and amplified with specific primers described previously . β ‐Actin was used as a control with an expected size of 353 bp with the primer pair 5′‐AGTGCCCATCTACGAAGGTT‐3′ and 5′‐CAGTATCCATGAGACCACCTACA‐3′.…”

“…DNAMAN software (DNAMAN 5.2.2; Lynnon BioSoft, Quebec, Canada) was used to assemble full‐length sequences, which were confirmed by end‐to‐end PCR with primers corresponding to the 3′ and 5′ ends (supporting information Table S2). PCR fragments of the expected lengths were cloned and sequenced as described above . Full‐length sequences were submitted to GenBank (accession numbers JX566819, JX566820, JX566823 and JX566828 for CYP6AY3v2, CYP306A2v2, CYP353D1v2 and LS CE36).…”

Viral infection induces different detoxification enzyme activities in insecticide-resistant and -susceptible brown planthopper <i>Nilaparvata lugens</i> strains

“…23) P450 has an important role in metabolizing xenobiotics, such as drugs, insecticides, and plant toxins. Insecticide-selected BPH individuals overexpress cytochrome P450 (CYP) genes encoding P450 enzymes [24][25][26][27][28] and also show promoter polymorphism, 29) wherein the CYP and CE genes are overexpressed in response to the organophosphate chlorpyrifos. 16) On the other hand, BPH acquires and transmits rice ragged stunt virus (RRSV; Reoviridae, Fijivirus) [30][31][32][33] and rice grassy stunt virus (RGSV; Tenuivirus) 33,34) by feeding on infected plants, accelerating the severe damage on growing rice plants.…”