Overexpression of MMP9 in macrophages attenuates pulmonary fibrosis induced by bleomycin☆

Cabrera, Sandra; Gaxiola, Miguel; Arreola, José Luis; Ramı́rez, Remedios; Jara, Paul; DʼArmiento, Jeanine; Richards, Thomas J.; Selman, Moisés; Pardo, Annie

doi:10.1016/j.biocel.2007.06.022

Cited by 105 publications

(81 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There were no significant differences in levels of metalloproteinase (MMP); TIMP1; cathepsins B, D, L, and K; or urokinase (Supplemental Figure 3A). We also found no difference in the enzymatic activity of MMP2 and MMP9, two proteases with important roles in lung fibrosis (25)(26)(27), by gelatin zymography of lung homogenates taken at 7, 14, 21, and 28 days after bleomycin injury (Supplemental Figure 3B and data not shown). We also evaluated the production of MMP8 (neutrophil collagenase) by Western blot on days 3 and 14 after bleomycin treatment and found no difference between Mfge8 -/-and control mice (Supplemental Figure 3, C and D).…”

Section: Mfge8 Targets Collagen For Uptake By Macrophages Collagen Imentioning

confidence: 68%

Mfge8 diminishes the severity of tissue fibrosis in mice by binding and targeting collagen for uptake by macrophages

Atabai¹,

Jamé²,

Azhar³

et al. 2009

J. Clin. Invest.

198

195

View full text Add to dashboard Cite

Milk fat globule epidermal growth factor 8 (Mfge8) is a soluble glycoprotein known to regulate inflammation and immunity by mediating apoptotic cell clearance. Since fibrosis can occur as a result of exaggerated apoptosis and inflammation, we set out to investigate the hypothesis that Mfge8 might negatively regulate tissue fibrosis. We report here that Mfge8 does decrease the severity of tissue fibrosis in a mouse model of pulmonary fibrosis; however, it does so not through effects on inflammation and apoptotic cell clearance, but by binding and targeting collagen for cellular uptake through its discoidin domains. Initial analysis revealed that Mfge8 -/-mice exhibited enhanced pulmonary fibrosis after bleomycin-induced lung injury. However, they did not have increased inflammation or impaired apoptotic cell clearance after lung injury compared with Mfge8 +/+ mice; rather, they had a defect in collagen turnover. Further experiments indicated that Mfge8 directly bound collagen and that Mfge8 -/-macrophages exhibited defective collagen uptake that could be rescued by recombinant Mfge8 containing at least one discoidin domain. These data demonstrate a critical role for Mfge8 in decreasing the severity of murine tissue fibrosis by facilitating the removal of accumulated collagen.

show abstract

Section: Mfge8 Targets Collagen For Uptake By Macrophages Collagen Imentioning

confidence: 68%

Mfge8 diminishes the severity of tissue fibrosis in mice by binding and targeting collagen for uptake by macrophages

Atabai¹,

Jamé²,

Azhar³

et al. 2009

J. Clin. Invest.

198

195

View full text Add to dashboard Cite

show abstract

“…The macrophage delivery system provides specific directed expression of the transgene (21,31). The generation of these mice was described previously (4). To screen the mice, the primers for PCR were left (5Ј to 3Ј), CAGAACAGAATACCAGTTTGTATC, and right (5Ј to 3Ј), GCCAGGACCGCTTCTACTGGCGCGT.…”

Section: Methodsmentioning

confidence: 99%

“…To screen the mice, the primers for PCR were left (5Ј to 3Ј), CAGAACAGAATACCAGTTTGTATC, and right (5Ј to 3Ј), GCCAGGACCGCTTCTACTGGCGCGT. For the experiments described below, we utilized mice that exhibited macrophage MMP-9 activity levels in culture comparable with human macrophages (4).…”

Section: Methodsmentioning

confidence: 99%

Transgenic expression of matrix metalloproteinase-9 causes adult-onset emphysema in mice associated with the loss of alveolar elastin

Foronjy

Nkyimbeng

Wallace

et al. 2008

American Journal of Physiology-Lung Cellular and Molecular Phys

104

View full text Add to dashboard Cite

has been consistently identified in the lungs of patients with chronic obstructive pulmonary disease (COPD). However, its role in the development of the disease remains undefined. Mice that specifically express human MMP-9 in their macrophages were generated, and morphometric, biochemical, and histological analyses were conducted on the transgenic and littermate control mice over 1 yr to determine the effect of macrophage MMP-9 expression on emphysema formation and lung matrix content. Lung morphometry was normal in transgenic mice at 2 mo of age (mean linear intercept ϭ 50 Ϯ 3 littermate mice vs. 51 Ϯ 2 transgenic mice). However, after 12 mo of age, the MMP-9 transgenic mice developed significant air space enlargement (mean linear intercept ϭ 53 Ϯ 3 littermate mice vs. 61 Ϯ 2 MMP-9 transgenic mice; P Ͻ 0.04). Lung hydroxyproline content was not significantly different between wild-type and transgenic mice, but MMP-9 did significantly decrease alveolar wall elastin at 1 yr of age (4.9 Ϯ 0.3% area of alveolar wall in the littermate mice vs. 3.3 Ϯ 0.3% area of alveolar wall in the MMP-9 mice; P Ͻ 0.004). Thus these results establish a central role for MMP-9 in the pathogenesis of this disease by demonstrating that expression of this protease in macrophages can alter the extracellular matrix and induce progressive air space enlargement in mice.protease; extracellular matrix; degradation; macrophage SEVERAL STUDIES HAVE IMPLICATED matrix metalloproteinase (MMP)-9 in the pathogenesis of emphysema. Increased MMP-9 levels were detected in emphysema lung samples (36), and enhanced expression of this protease was noted in alveolar macrophages from chronic obstructive pulmonary disease (COPD) patients (11,43). Similarly, elevated MMP-9 expression and activity were identified in animal models of the disease (58, 68) and were thought to play a role in the destructive process. While these studies associate MMP-9 activity with emphysema, they do not establish that MMP-9 is directly capable of generating structural changes in this disease. Indeed, MMP-9 could be functioning primarily to mediate postinjury repair response in the lungs of COPD patients (29,30). Alveolar macrophages are a major site of production of matrix-degrading enzymes in the lung (11), and these cells exert a key role on the alveolar destruction that occurs in this disease (65,66). Macrophages secrete several proteases that have been implicated in emphysema formation, including the elastolytic cysteine proteinases (cathepsin L and cathepsin S) and several MMPs (MMP-1, -9, and -12; Ref. 49). MMP-9, however, is the protease that has been most consistently identified from the alveolar macrophages of COPD patients (32, 44). Macrophages from COPD patients have increased MMP-9 expression (12) and release greater amounts of MMP-9 upon stimulation with cigarette smoke compared with macrophages from smoking and nonsmoking control subjects (43). These findings are relevant, as MMP-9 is capable of degrading key components of the extracellular matrix (24). Thus its exp...

show abstract

“…After bleomycin installation, MMP-9-null mice develop fibrosis that is similar to that developed by wild-type animals, although the lungs of MMP-9-deficient mice show minimal alveolar bronchiolisation, suggesting that that MMP-9 facilitates migration of Clara cells and other bronchiolar cells into the regions of alveolar injury [45]. Alternatively, overexpression of MMP-9 in macrophages has been shown to attenuate bleomycin-induced fibrosis [46]. The reduction of profibrotic mediators, such as TIMP-1 and insulin-like growth factorbinding protein (IGFBP)-3, in MMP-9 transgenic mice was identified as a potential mechanism of the diminished fibrotic response.…”

Section: Mmp-9mentioning

confidence: 99%

Metalloproteinases in idiopathic pulmonary fibrosis

2011

View full text Add to dashboard Cite

In this article, we outline the current state of knowledge about the balance between collagen production and degradation in idiopathic pulmonary fibrosis (IPF). The dysregulated action of metalloproteinases implicated in IPF may play a central role in IPF pathogenesis. Inhibiting metalloproteinases in IPF may, therefore, have therapeutic potential, but our knowledge of their pathophysiological role is held back by limited animal models and the lack of specific inhibitors.

show abstract

Overexpression of MMP9 in macrophages attenuates pulmonary fibrosis induced by bleomycin☆

Cited by 105 publications

References 40 publications

Mfge8 diminishes the severity of tissue fibrosis in mice by binding and targeting collagen for uptake by macrophages

Mfge8 diminishes the severity of tissue fibrosis in mice by binding and targeting collagen for uptake by macrophages

Transgenic expression of matrix metalloproteinase-9 causes adult-onset emphysema in mice associated with the loss of alveolar elastin

Metalloproteinases in idiopathic pulmonary fibrosis

Contact Info

Product

Resources

About