Overexpression of HOP2 induces developmental defects and compromises growth in Arabidopsis

Abstract

HOMOLOGOUS PAIRING 2 (HOP2) is a predominantly meiotic protein that plays a pivotal role in homologous chromosome pairing in organisms as diverse as yeast and mammals. While generating HOP2::GFP reporter lines, we identified two Arabidopsis T-DNA insertion mutants, stunted1 (std1) and stunted2 (std2) that exhibit pleiotropic phenotypes, including fasciated stems, altered phyllotaxy, floral organ defects, reduced fecundity, and an overall reduction in growth properties. TAIL-PCR followed by sequencing revealed several insertions near genes, but genotyping showed that none of the insertions are causal. Analysis the std mutants by qRT-PCR, and analysis of dexamethasone inducible HOP2 transgenic plants demonstrated that the std phenotypes are associated with ectopic/overexpression of HOP2. Based on the postulated mechanisms of HOP2 action, we speculate on how overexpression leads to these developmental/growth defects.

Genomic targets of HOP2 are enriched for features found at recombination hotspots

“…TAIL-PCR was conducted essentially as described (Garrido et al 2021), using the same arbitrary primers, but with LB1.3 (5’ ATTTTGCCGATTTCGGAAC 3’) directed towards the left T-DNA border, and EGAD BACK (5’ CCTGACTCCCTTAATTCTCCGCTCAT 3’) directed towards the right T-DNA border.…”