Overexpression of c-maf is a frequent oncogenic event in multiple myeloma that promotes proliferation and pathological interactions with bone marrow stroma

Abstract

The oncogene c-maf is translocated in approximately 5%-10% of multiple myelomas. Unexpectedly, we observed c-maf expression in myeloma cell lines lacking c-maf translocations and in 50% of multiple myeloma bone marrow samples. By gene expression profiling, we identified three c-maf target genes: cyclin D2, integrin beta7, and CCR1. c-maf transactivated the cyclin D2 promoter and enhanced myeloma proliferation, whereas dominant inhibition of c-maf blocked tumor formation in immunodeficient mice. c-maf-driven expression of integrin beta7 enhanced myeloma adhesion to bone marrow stroma and increased production of VEGF. We propose that c-maf transforms plasma cells by stimulating cell cycle progression and by altering bone marrow stromal interactions. The frequent overexpression of c-maf in myeloma makes it an attractive target for therapeutic intervention.

CD13/APN transcription is regulated by the proto-oncogene c-Maf via an atypical response element

“…Aberrant expression of c-Maf activates multiple pathways that mediate tumorigenesis either by the direct induction of cell cycle proteins or indirectly by promoting tumor-stroma interactions (Hurt et al, 2004,Suzuki et al, 2005. While ectopic expression of c-Maf transforms chicken embryonic fibroblasts (Kataoka et al, 1993), overexpression of c-Maf, MafB, or L-Maf in primary embryonic neuroretinal cells does not result in their transformation.…”

“…Considering its function as an oncogene, c-Maf provides a particularly interesting transcriptional regulator in endothelial cells. The aberrant and specific upregulation of the expression of cyclin D2, integrin β7, and the chemokine receptor CCR1 genes has been reported in c-Maf overexpressing multiple myeloma cell lines which contributes to tumorigenicity (Hurt et al, 2004). Since endothelial cells normally express these genes (Strasly et al, 2004) they may also be angiogenically relevant targets of c-Maf in endothelial cells.…”

“…The siRNA were constructed with the Silencer siRNA Construction Kit (Ambion, Austin, TX) to target three different sequences within the coding region of c-Maf: 1179 Sense strand: aacttccaggtgcgccttctgcctgtctc; 1184S: aagtagtcttccaggtgcgcc cctgtctc, 1996S: aattgtcgctgctcgagccgtcctgtctc (Hurt et al, 2004). The siRNA were tested for their specificity and efficiency of knocking down protein expression of newly transcribed RNA by co-transfecting various expression plasmids (c-Maf, MafB, and cFos) and 10nM of each individual siRNA.…”

“…cDNA was reverse transcribed with SuperscriptII (Invitrogen) and amplified with the forward (5′-gcttcc gagaaaacggctc-3′) and reverse (5′-tgcgag tgggctcagttatg-3′) primers as described (Hurt et al, 2004). PCR products were probed with the internal oligo 5′-cgacaacccgtcctctcc cgagttt-3′ probe by Southern blot.…”

“…6A). The c-Maf overexpressing human multiple myeloma line OPM2 served as a positive control (Hurt et al, 2004).…”