Outbreak of Chagas disease in Brazil: Validation of a molecular diagnostic method

Costa-Oliveira, Cíntia Nascimento da; Paiva-Cavalcanti, Milena de; Barros, Michelle da Silva; Nakazawa, Mineo; Melo, Maria Gabriella Nunes de; Silva, Rômulo Pessoa e; Torres, Diego José Lira; Oliveira, Kamila Kássia dos Santos; Moreira, Leyllane Rafael; Morais, Rayana Carla Silva de; Goes, Tayná Correia de; Oliveira, Gênova Maria de Azevedo; Júnior, Wilson de Oliveira; Silva, Milena Maria de Morais E.; Batista, Filipe; Montenegro, Demetrius; Lorena, Virgínia Maria Barros de

doi:10.1016/j.exppara.2023.108478

Cited by 5 publications

(6 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…No Brasil, a PCR quantitativa também foi exitosa na avaliação da DC aguda em amostras de 77 pacientes pernambucanos, chegando-se a conclusão de que a qPCR deveria ser incorporada ao diagnóstico de casos suspeitos de DC aguda (68). Além disso, o qPCR foi considerado uma ferramenta auxiliar para estudos que requeiram o isolamento do T. cruzi da corrente sanguínea de pacientes com DC crônica, após o estabelecimento de um ponto de corte de carga parasitária que garanta uma taxa relativa de sucesso (44,54,62).…”

Section: Resultsunclassified

A biologia molecular como ferramenta para o diagnóstico da Doença de Chagas

De Melo,

Ferrari

2023

Braz. J. Hea. Rev.

View full text Add to dashboard Cite

As doenças negligenciadas (DN) são um conjunto de doenças infecciosas prevalentes, caracterizada pelo alto grau de morbilidade afetando a qualidade de vida e gerando impactos sócio-econômicos negativos para a população mais vulnerável. As DN despertam pouco atrativo financeiro por parte da indústria farmacêutica uma vez que não atingem o grande mercado consumidor de países desenvolvidos. Dentre as doenças negligenciadas estão a tuberculose, hanseníase e malária, enquanto a doença de Chagas é intitulada como uma das mais negligenciadas. Desde sua descoberta, em 1909, por Carlos Chagas, a doença de Chagas tem sido estudada ininterruptamente na busca pelo aprimoramento do diagnóstico da doença. Este estudo consiste em uma revisão de literatura integrativa realizada a partir de pesquisa em plataformas de busca, e objetivou fornecer um panorama atualizado do papel da Biologia Molecular no diagnóstico da doença de Chagas, considerada uma doença negligenciada no Brasil. A Biologia Molecular tem contribuído bastante no campo referente à DC, seja no diagnóstico, no monitoramento, no prognóstico, no desenvolvimento de terapias alvo e até na avaliação da carga e viabilidade parasitárias.

show abstract

Section: Resultsunclassified

A biologia molecular como ferramenta para o diagnóstico da Doença de Chagas

De Melo,

Ferrari

2023

Braz. J. Hea. Rev.

View full text Add to dashboard Cite

show abstract

“…Then, the final pellet was transferred to 1.5 mL microtubes, and extraction was performed with the QIAamp DNA Mini Kit – QIAGEN according to the manufacturer‘s recommendations. The primers TcSAT1 – F (5′AAATTCCTCCAAGCAGCGGA3′) and TcSAT2 – R (5′ ATGAATGGCGGGAGTCAGAG3′) were used to amplify the T. cruzi satellite DNA (SAT-DNA), as described previously ( 21 ). T. cruzi genomic DNA (strain Y) was used to generate a standard curve to quantify the parasite load in samples by quantitative PCR (qPCR).…”

Section: Methodsmentioning

confidence: 99%

“…T. cruzi genomic DNA (strain Y) was used to generate a standard curve to quantify the parasite load in samples by quantitative PCR (qPCR). Quantification of parasite load was performed with the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) using the TcSAT-IAM system ( 21 ). Samples were tested in duplicate at all stages.…”

Section: Methodsmentioning

confidence: 99%

Interaction between peripheral blood mononuclear cells and Trypanosoma cruzi-infected adipocytes: implications for treatment failure and induction of immunomodulatory mechanisms in adipose tissue

Moreira,

Silva,

Costa-Oliveira

et al. 2024

Front. Immunol.

Self Cite

View full text Add to dashboard Cite

Background/IntroductionAdipose tissue (AT) has been highlighted as a promising reservoir of infection for viruses, bacteria and parasites. Among them is Trypanosoma cruzi, which causes Chagas disease. The recommended treatment for the disease in Brazil is Benznidazole (BZ). However, its efficacy may vary according to the stage of the disease, geographical origin, age, immune background of the host and sensitivity of the strains to the drug. In this context, AT may act as an ally for the parasite survival and persistence in the host and a barrier for BZ action. Therefore, we investigated the immunomodulation of T. cruzi-infected human AT in the presence of peripheral blood mononuclear cells (PBMC) where BZ treatment was added.MethodsWe performed indirect cultivation between T. cruzi-infected adipocytes, PBMC and the addition of BZ. After 72h of treatment, the supernatant was collected for cytokine, chemokine and adipokine assay. Infected adipocytes were removed to quantify T. cruzi DNA, and PBMC were removed for immunophenotyping.ResultsOur findings showed elevated secretion of interleukin (IL)-6, IL-2 and monocyte chemoattractant protein-1 (MCP-1/CCL2) in the AT+PBMC condition compared to the other controls. In contrast, there was a decrease in tumor necrosis factor (TNF) and IL-8/CXCL-8 in the groups with AT. We also found high adipsin secretion in PBMC+AT+T compared to the treated condition (PBMC+AT+T+BZ). Likewise, the expression of CD80+ and HLA-DR+ in CD14+ cells decreased in the presence of T. cruzi.DiscussionThus, our findings indicate that AT promotes up-regulation of inflammatory products such as IL-6, IL-2, and MCP-1/CCL2. However, adipogenic inducers may have triggered the downregulation of TNF and IL-8/CXCL8 through the peroxisome proliferator agonist gamma (PPAR-g) or receptor expression. On the other hand, the administration of BZ only managed to reduce inflammation in the microenvironment by decreasing adipsin in the infected culture conditions. Therefore, given the findings, we can see that AT is an ally of the parasite in evading the host‘s immune response and the pharmacological action of BZ.

show abstract

“…7,17 Conflicting results may be explained by an insufficient antibody production, and, in these cases, molecular methods for detection of T. cruzi DNA have been used as an excellent alternative for these cases. [18][19][20] Immunochromatography (rapid test) has been used for point-of-care testing of T-cruzi infection among family members of patients in field works or at outpatient clinics. 21 Serological tests are subsequently performed to confirm.…”

Section: Laboratorymentioning

confidence: 99%

“…Recently, one of the largest outbreaks in Brazil has occurred in Pernambuco, and the diagnosis of suspected cases was only possible by real-time polymerase chain reaction (PCR) using the TcSAT-IAM. 18 Besides, this method has been suggested to monitor the etiological treatment in the chronic phase, 22 since today the criteria for cure of CD is antibody decay analyzed by serological techniques, which may take many years.…”

Section: Laboratorymentioning

confidence: 99%

Advances in Clinical Practice, Diagnosis and Treatment of Chronic Chagas’ Heart Disease

Alves¹,

Silva²,

Barbosa³

et al. 2023

ABC Heart Fail Cardiomyop

Self Cite

View full text Add to dashboard Cite

Chagas disease has become globalized as a result of the migratory process of infected patients to non-endemic areas. With the considerable number of individuals affected by the disease, detection and treatment of its chronic manifestations is a relevant and necessary issue. Growing attention has been paid to chronic Chagas cardiomyopathy (CCC), which includes heart failure, malignant arrhythmias, conduction disturbances and thromboembolic events. Many pharmacological and nonpharmacological treatments for CCC are still extrapolations of existing evidence on the treatment of other clinical conditions, highlighting the need of including this group of patients in future studies. In this review, we will discuss the most recent data from the literature and clinical practice on the diagnosis and treatment of CCC. IntrodutionChagas disease (CD) is a neglected tropical disease that affects socially vulnerable individuals that experience stigma, discrimination and high morbidity and mortality, especially those with the cardiac form of the disease. 1,2 Changes in the epidemiological landscape of CD have been described worldwide.With the migratory phenomenon, CD has become globalized. Especially coming from the Latin America, CD

show abstract

Outbreak of Chagas disease in Brazil: Validation of a molecular diagnostic method

Cited by 5 publications

References 36 publications

A biologia molecular como ferramenta para o diagnóstico da Doença de Chagas

A biologia molecular como ferramenta para o diagnóstico da Doença de Chagas

Interaction between peripheral blood mononuclear cells and Trypanosoma cruzi-infected adipocytes: implications for treatment failure and induction of immunomodulatory mechanisms in adipose tissue

Advances in Clinical Practice, Diagnosis and Treatment of Chronic Chagas’ Heart Disease

Contact Info

Product

Resources

About