Osteogenic potential of adipose mesenchymal stem cells is not correlated with aortic valve calcification

Abstract

Osteogenic transformation as a result of cellular plasticity could be both beneficial, in the case of bone formation, and hazardous, in the case of vascular calcification. Mechanisms driving vascular calcification remain poorly understood, while calcification of the vessels is one of the leading causes of morbidity and mortality. In particular, calcification of the aortic valve is a serious complication requiring surgical intervention. The mechanisms behind aortic valve calcification and the origin of cells driving osteogenic transformation of the aortic valve remain questionable. A circulating stem cell theory supports the view that pathologic calcification could originate not only from valve cells, but also from other sources. The aim of this study was to estimate the osteogenic potential of adipose tissue-derived mesenchymal stem cells (MSCs) from people with calcification of the aortic valve versus MSCs from healthy people; further, to compare the capacity of osteogenic differentiation between MSCs and valve interstitial cells (VICs) from healthy donors and patients with severe calcification of the aortic valve. MSCs and VICs were isolated from either healthy donors or from patients with aortic valve calcification. The cells were immunophenotyped for conventional MSC markers by flow cytometry. Osteogenic differentiation was induced by addition of specific osteogenic inductors to the culture medium. Osteogenic differentiation was assessed by alizarin red staining and by estimation of RUNX2 expression by qPCR. The MSCs of healthy donors were capable of efficient osteogenic differentiation, while MSCs of the patients with aortic valve calcification were not capable of osteogenic differentiation. We conclude that there is no correlation between the capacity of adipose MSCs to osteogenically transform and calcification of the aortic valve. Most likely, peripheral MSCs of adipose origin could not be a source of aortic valve calcification.

CD73 Rather Than CD39 Is Mainly Involved in Controlling Purinergic Signaling in Calcified Aortic Valve Disease

“…Patients with severe aortic stenosis underwent surgical heart valve replacement. Primary interstitial cells were obtained from the leaflets of the excised heart valves, isolated by using collagenase, and cultured until confluent monolayer as it is previously described (Kostina et al, 2018; Malashicheva et al, 2018). Cells obtained after passages 2–4 were used in further experiments.…”

“…The corresponding gene expression level was normalized to GAPDH from the same samples. Changes in target gene expression levels were calculated as fold differences using the comparative ΔΔCT method (F: AATGAAGGGGTCATTGATGG; R: AAGGTGAAGGTCGGAGTCAA) (Kostina et al, 2018; Malashicheva et al, 2018). RUNX2 (runt-related transcription factor 2), (F:TGGATCACCTGAAAATGCTG;R:CGAAATCCCAACTCCGATA) OPN (osteopontin), (F: TCACCTGTGCCATACCAGTTAAA; R:TGGGTATTTGTTGTAAAGCTGCTT) and BMP2 (bone morphogenetic protein 2) (F: GCCAGCCGAGCCAACAC; R: CCCACTCGTTTCTGGTAGTTCTTC) were investigated on the seventh day after ATP or adenosine stimulation.…”