Osmotic Stress Regulates Mineralocorticoid Receptor Expression in a Novel Aldosterone-Sensitive Cortical Collecting Duct Cell Line

Viengchareun, Say; Kamenický, Peter; Teixeira, Marie; Butlen, Daniel; Meduri, Géri; Blanchard‐Gutton, Nicolas; Kurschat, Christine; Lanel, Aurélie; Martinerie, Lætitia; Sztal‐Mazer, Shoshana; Blot‐Chabaud, Marcel; Ferrary, Évelyne; Cherradi, Nadia; Lombès, Marc

doi:10.1210/me.2009-0095

Cited by 43 publications

(44 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…TonEBP is a crucial mediator of adaptive cellular responses to osmotic stress. TonEBP expression is increased and decreased by acute hypertonicity and hypotonicity, respectively (103). In contrast to these findings in acute osmotic stress, TonERB expression in the PVN was not significantly different between our rats on a chronically high-or low-sodium diet to which they had become adapted, as confirmed by normal plasma sodium values that did not differ between groups or from pooled rat serum from the colony on their standard sodium chow.…”

Section: Discussionsupporting

confidence: 42%

“…Regulatory sequences of the MR gene include MR, GR, GPR48, and TonEBP (77,82,103,105). Activated MR and GR increase MR gene transcription through the P1 and P2 promoters (77,82).…”

Section: Discussionmentioning

confidence: 99%

“…Real-time PCR primers for the rat MR were designed as follows: sense primer: GCGAAACAGATGATC-CAGG and antisense primer: CAACTCAAAGCGAACGATGA. The primers for TonEBP were sense primer: CCTCTCCTCACCGTCGT-CATC and antisense primer: CTCCCACCTCCTTCTCATTCTG (103). The primers for GAPDH as a reference gene (47) were described previously.…”

Section: Methodsmentioning

confidence: 99%

“…Because the 11␤-HSD 1 and 2 enzymes are responsible for prereceptor regulation of ligand for the MR, their expression was also assessed. Plasma sodium and the expression of tonicity-responsive enhancer binding protein (TonEBP) in the PVN were measured to assess the level of adaptation of the rats to the chronic diet regimens (103). Neuronal activation within the region of the PVN, where the preautonomic neurons reside was assessed by c-Fos expression.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Expression of mineralocorticoid and glucocorticoid receptors in preautonomic neurons of the rat paraventricular nucleus

Chen

Gómez-Sánchez

Penman

et al. 2014

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

Activation of mineralocorticoid receptors (MR) of the hypothalamic paraventricular nucleus (PVN) increases sympathetic excitation. To determine whether MR and glucocorticoid receptors (GR) are expressed in preautonomic neurons of the PVN and how they relate to endogenous aldosterone levels in healthy rats, retrograde tracer was injected into the intermediolateral cell column at T4 to identify preautonomic neurons in the PVN. Expression of MR, GR, 11-␤ hydroxysteroid dehydrogenase1 and 2 (11␤-HSD1, 2), and hexose-6-phosphate dehydrogenase (H6PD) required for 11␤-HSD1 reductase activity was assessed by immunohistochemistry. RT-PCR and Western blot analysis were used to determine MR gene and protein expression. Most preautonomic neurons were in the caudal mediocellular region of PVN, and most expressed MR; none expressed GR. 11␤-HSD1, but not 11␤-HSD2 nor H6PD immunoreactivity, was detected in the PVN. In rats with chronic low or high sodium intakes, the low-sodium diet was associated with significantly higher plasma aldosterone, MR mRNA and protein expression, and c-Fos immunoreactivity within labeled preautonomic neurons. Plasma corticosterone and sodium and expression of tonicity-responsive enhancer binding protein in the PVN did not differ between groups, suggesting osmotic adaptation to the altered sodium intake. These results suggest that MR within preautonomic neurons in the PVN directly participate in the regulation of sympathetic nervous system drive, and aldosterone may be a relevant ligand for MR in preautonomic neurons of the PVN under physiological conditions. Dehydrogenase activity of 11␤-HSD1 occurs in the absence of H6PD, which regenerates NADP ϩ from NADPH and may increase MR gene expression under physiological conditions. mineralocorticoid receptor; aldosterone; sympathetic nervous system; preautonomic neuron; paraventricular nucleus; glucocorticoid receptor; 11-␤ hydroxysteroid dehydrogenase; sodium THE RENIN-ANGIOTENSIN-ALDOSTERONE system (RAAS) and sympathetic nervous system (SNS) interact to maintain fluid, electrolyte, and hemodynamic homeostasis essential for terrestrial life where sodium intake is often limited. Both the RAAS and SNS are activated by a lowering sodium intake, adaptive mechanisms ensuring adequate blood pressure (17,51,52,60,64,104). The paraventricular nucleus (PVN), and the SNS were shown by ablation studies to have a crucial role in mineralocorticoid-salt excess models of hypertension (6, 58). Chronic systemic aldosterone excess, as well as the intracerebroventricular infusion of aldosterone administered at concentrations too low to be effective when infused systemically, increase blood pressure and SNS activity (35,61). In both models, the hypertension and sympathetic activation are prevented by the intracerebroventricular infusion of mineralocorticoid receptor (MR) antagonists at doses lower than the effective dose infused peripherally (35,39,61). Xue et al. (108) reproduced these pharmacological results with the intracerebroventricular infusion of MR siRNA (108).The ...

show abstract

Section: Discussionsupporting

confidence: 42%

“…Regulatory sequences of the MR gene include MR, GR, GPR48, and TonEBP (77,82,103,105). Activated MR and GR increase MR gene transcription through the P1 and P2 promoters (77,82).…”

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Expression of mineralocorticoid and glucocorticoid receptors in preautonomic neurons of the rat paraventricular nucleus

Chen

Gómez-Sánchez

Penman

et al. 2014

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

show abstract

“…We next demonstrated by Western blot analysis using the anti-MR 39N antibody raised against the first highly conserved amino acids of the primary MR sequence, thus recognizing both mMR and hMR (69), that MR protein expression was threefold higher in inguinal AT of Tg mice compared with WT mice (Fig. 1, D and E).…”

Section: Resultsmentioning

confidence: 95%

Paradoxical resistance to high-fat diet-induced obesity and altered macrophage polarization in mineralocorticoid receptor-overexpressing mice

Kuhn

Bourgeois

Keo

et al. 2014

American Journal of Physiology-Endocrinology and Metabolism

Self Cite

View full text Add to dashboard Cite

vitro, yet its in vivo metabolic impact remains elusive. Wild type (WT) and transgenic (Tg) mice overexpressing human MR were subjected to standard chow (SC) or high-fat diet (HFD) for 16 wk. Tg mice had a lower body weight gain than WT animals and exhibited a relative resistance to HFD-induced obesity. This was associated with a decrease in fat mass, an increased population of smaller adipocytes, and an improved glucose tolerance compared with WT animals. Quantitative RT-PCR studies revealed decreased expression of PPAR␥2, a master adipogenic gene, and of glucocorticoid receptor and 11␤-hydroxysteroid dehydrogenase type 1, consistent with an impaired local glucocorticoid signaling in adipose tissues (AT). This paradoxical resistance to HFD-induced obesity was not related to an adipogenesis defect since differentiation capacity of Tg preadipocytes isolated from stroma-vascular fractions was unaltered, suggesting that other nonadipocyte factors might compromise AT development. Although AT macrophage infiltration was not different between genotypes, Tg mice exhibited a distinct macrophage polarization, as revealed by FACS analysis and CD11c/CD206 expression studies. We further demonstrated that Tg macrophage-conditioned medium partially impaired preadipocyte differentiation. Therefore, we propose that modification of M1/M2 polarization of hMR-overexpressing macrophages could account in part for the metabolic phenotype of Tg mice. Collectively, our results provide evidence that MR exerts a pivotal immunometabolic role by controlling adipocyte differentiation processes directly but also indirectly through macrophage polarization regulation. Our findings should be taken into account for the pharmacological treatment of metabolic disorders. adipocyte; glucocorticoid signaling; energy homeostasis; immunometabolism; mineralocorticoid receptor THE OBESITY PANDEMIC OF OUR INDUSTRIALIZED COUNTRIES is related to dramatic changes in nutritional and physical activities over the last decades. More recently, it was reported that obesity is a proinflammatory state characterized by adipose tissue (AT) inflammation, including AT infiltration by macrophages and lymphocytes, and local and systemic overproduction of cytokines, chemokines, and prothrombotic factors (3,11,16,25,27,35,36,63,64,72,73). There is likely a causal relationship between the obesity-associated remodeling of AT and the development of insulin resistance, type 2 diabetes, and cardiovascular diseases (14,36,74). Conversely, weight loss in obese patients decreases the magnitude of AT inflammation (7, 12, 15, 21, 62, 68a).The mineralocorticoid receptor (MR), a steroid receptor belonging to the nuclear receptor superfamily of transcription factors, plays a key role in hydroelectrolytic homeostasis in epithelial tissues such as kidney and colon. Because of similar affinity of the MR for aldosterone and cortisol (1, 24), the tissue selectivity of aldosterone effects is ensured by the presence of the 11␤-hydroxysteroid dehydrogenase type 2 (11HSD2), an enzyme that conve...

show abstract

RNA-binding protein HuR enhances mineralocorticoid signaling in renal KC3AC1 cells under hypotonicity

Lema¹,

Amazit²,

Lamribet³

et al. 2017

Cell. Mol. Life Sci.

View full text Add to dashboard Cite

Mineralocorticoid receptor (MR) mediates the sodium-retaining action of aldosterone in the distal nephron. Herein, we decipher mechanisms by which hypotonicity increases MR expression in renal principal cells. We identify HuR (human antigen R), an mRNA-stabilizing protein, as an important posttranscriptional regulator of MR expression. Hypotonicity triggers a rapid and reversible nuclear export of HuR in renal KC3AC1 cells, as quantified by high-throughput microscopy. We also identify a key hairpin motif in the 3'-untranslated region of MR transcript, pivotal for the interaction with HuR and its stabilizing function. Next, we show that hypotonicity increases MR recruitment onto Sgk1 promoter, a well-known MR target gene, thereby enhancing aldosterone responsiveness. Our data shed new light on the crucial role of HuR as a stabilizing factor for the MR transcript and provide evidence for a short autoregulatory loop in which expression of a nuclear receptor transcriptionally regulating water and sodium balance is controlled by osmotic tone.

show abstract

Osmotic Stress Regulates Mineralocorticoid Receptor Expression in a Novel Aldosterone-Sensitive Cortical Collecting Duct Cell Line

Cited by 43 publications

References 70 publications

Expression of mineralocorticoid and glucocorticoid receptors in preautonomic neurons of the rat paraventricular nucleus

Expression of mineralocorticoid and glucocorticoid receptors in preautonomic neurons of the rat paraventricular nucleus

Paradoxical resistance to high-fat diet-induced obesity and altered macrophage polarization in mineralocorticoid receptor-overexpressing mice

RNA-binding protein HuR enhances mineralocorticoid signaling in renal KC3AC1 cells under hypotonicity

Contact Info

Product

Resources

About