Organizational Variation of DYZ1 Repeat Sequences on the Human Y Chromosome and Its Diagnostic Potentials

Abstract

The long arm of the human Y chromosome is flecked with various fractions of repetitive DNA. DYZ1 is one such fraction, which is organized tandemly as an array of a 3.4-kb repeat ranging from 2000-4000 copies in normal males. We have studied the organizational variation of the DYZ1 fraction on the human Y chromosome using DNA samples from CEPH family members and the random population employing the RFLP approach, fluorescence in situ hybridization (FISH), and conducted a similarity search with GenBank sequences. Typing of genomic DNA using DYZ1 as a probe showed an allele length and copy number variations even between two male siblings. Hybridization of DNA from monochromosome hybrids with this probe showed its presence on chromosome 15 in addition to the Y chromosome. Fluorescence in situ hybridization of metaphase chromosomes from an apparently normal male showed DYZ1 sequences in the proximal region of chromosome 11 in addition to the long arm of the Y chromosome. Typing of sets of semen and blood DNA samples from the same human individuals showed discernible allelic variation between the two samples, indicating tissue-specific programmed sequence modulation. DYZ1 seems to be the first probe having the unique potential to discriminate unequivocally the difference between the DNA originating from semen and blood samples, and may be exploited in forensic cases. This probe may also be used as a diagnostic tool to ascertain Y chromosome mosaicism in patients (e.g., Turner), its aberrant status in somatic cells, and possible sequence modulation/rearrangement in the germline samples. Additionally, this can be used to uncover sequence polymorphism in the human population. 561

The Conviction of Dr. Crippen: New Forensic Findings in a Century-Old Murder

“…Attempts to amplify amelogenin were negative (data not shown); therefore, sex determination of the slide tissue was accomplished through multiplex amplification of Y chromosomal and autosomal high copy number sequences (24,25). For the former, a 143‐bp DYZ1 repeat sequence on the Y chromosome containing 2000–4000 copies (26) was amplified using the primers 5′–GGCCTGTCCATTACACTACATTCC–3′ and 5′–GAATTGAATGGAATGGGAACGA–3′, and the TaqMan probe 5′–6FAM‐ATTCCAATCCATTCCTTT‐MGBNFQ–3′ (24). A 127‐bp repetitive sequence of the Ya5 Alu subfamily with similar copy number was amplified in tandem as a human/female DNA control, using the primers 5′–GAGATCGAGACCATCCCGGCTAAA–3′, 5′–CTCAGCCTCCCAAGTAGCTG–3′, and the TaqMan probe 5′–DHEX‐GGGCGTAGTGGCGGG‐DBH1–3′ (27).…”

Y Chromosome LncRNA Are Involved in Radiation Response of Male Non–Small Cell Lung Cancer Cells

“…The DYZ1 region has been described as genetically inert because it is composed of heterochromatin and, due to its highly repetitive nature, remains poorly sequenced (16). Previously attempted sequence analyses of the human Y chromosome have revealed numerous copies of the pentanucleotide repeat motif 5 0 -TTCCA-3 0 in the DYZ1 region (25,26). Only one previous publication has shown expression of two noncoding RNAs (AK128024.1 and AY598346.2) from the DYZ1 region in a testis-specific manner (27).…”

Development of two highly sensitive forensic sex determination assays based on human DYZ1 and Alu repetitive DNA elements

“…These elements, designated DYZ, are numbered in order of abundance. DYZ1 and DYZ2 are located on the long arm of the Y chromosome, the repeat units of which are 3.4 and 2.4 kb, respectively . DYZ1 can have up to 4000 copies , and DYZ2 has about 2000 copies .…”

“…DYZ1 and DYZ2 are located on the long arm of the Y chromosome, the repeat units of which are 3.4 and 2.4 kb, respectively . DYZ1 can have up to 4000 copies , and DYZ2 has about 2000 copies . The remaining three elements (DYZ3, DYZ4, and DYZ5) have 50 copies or less and range in size from 137 to 170 bp .…”

“…Although this assay is specific and reproducible, assaying DYZ5 still has sensitivity limitations, and amplification of more abundant DYZ repetitive elements could substantially increase the sensitivity of this type of assay. In this regard, diagnostic studies utilizing the DYZ1 repetitive element suggest that it may be well suited for highly sensitive testing of forensic samples.…”