Oral health and Candida carriage in socioeconomically disadvantaged US pregnant women

Abstract

BackgroundDespite the well-documented associations between poor maternal oral health and increased risk for adverse birth outcomes and dental caries in children after birth, prenatal oral health care is under-utilized, especially among the underserved population. In addition, oral Candida has recently been suggested as a potential culprit for children’s dental caries, with evident maternal contributions. Therefore, this study aimed to obtain epidemiological data on the oral health and oral Candida carriage in a cohort of underserved US pregnant women, and reveal factors associated with their oral Candida carriage.MethodsDemographic-medical-oral hygiene practice data were collected. Comprehensive oral examination was conducted. Caries status and plaque index were recorded. Oral samples (saliva, plaque and swab) were processed to identify Candida species and Streptococcus mutans by culturing-dependent and -independent methods. Multiple logistic regression analyses were used to identify factors associated with oral Candida carriage and caries severity.ResultsEighty-two socioeconomically disadvantaged women (48 pregnant and 34 non-pregnant) were enrolled. More pregnant women (79.1%) had > = 1 untreated decayed tooth when compared to their non-pregnant counterparts (47.1%) (p = 0.01). The average number of decayed teeth in pregnant and non-pregnant women was 3.9 and 3.1 (p > 0.05). Caries severity was positively associated with race (African American vs. white), plaque index and salivary Candida albicans level. C. albicans was the most predominant/abundant Candida strain, with cheek and tonsil as the most common colonized sites. The detection of C. albicans was 56%/56% in saliva and 40%/47% in plaque of the pregnant and non-pregnant groups, respectively. Study women’s oral Candida carriage is positively associated with hypertension [p = 0.03, odds ratio = 14.47(1.28, 163.51)], decayed teeth number [p = 0.04, odds ratio = 1.31 (1.01,1.69)] and salivary S. mutans level [p = 0.03, odds ratio = 4.80 (1.18–19.43)].ConclusionsSocioeconomically disadvantaged US women are in need of improved prenatal oral health, a large proportion of them have untreated decayed teeth and high carriage of oral Candida. Due to the observed significant association between the decayed teeth number and oral Candida carriage, providing oral health care during pregnancy (including limiting decayed teeth) will not only improve women’s oral health, but also present as a promising approach to reduce oral Candida carriage in women.

Changes in Candida albicans, Streptococcus mutans and oral health conditions following Prenatal Total Oral Rehabilitation among underserved pregnant women

“…Methods used for saliva and plaque sample collection were detailed previously [ 9 , 11 ]. Approximately 2 ml of whole non-stimulated saliva samples were collected by spitting into a sterile 50ml centrifuge tube.…”

“…and S. mutans on each plate were counted and recorded as colony forming unit (CFU). Additionally, C. albicans and S. mutans were further identified from microbial colony DNA using colony polymerase chain reaction method, detail detailed previously [ 9 , 11 ]. The probes used for C. albicans were forward primer 5′CGATTCAGGGGAGGTAGTGAC3′ and reverse primer 5′GGTTCGCCATAAATGGCTACCAG 3’.…”

“…Research from our team [ 5 , 6 , 7 , 8 , 9 ] and others [ 10 ] indicate that the severity of dental caries also disproportionately affects the underserved pregnant women. Among low-income US pregnant women, there is a stunning average of 4 untreated decayed teeth per person [ 11 ]. Moreover, poor prenatal oral health reduces oral health-related quality of life and results in avoidable emergency dental visits for orofacial pain and infections [ 12 , 13 ].…”

“…Traditional microbial risk markers for caries include Streptococcus mutans and Lactobacillus species [ 24 ]. Significantly, in the past decade, clinical studies have also observed and suggested the association between Candida albicans and dental caries in children and adults, together with S. mutans [ 7 , 9 , 11 , 25 , 26 , 27 ]. Furthermore, despite several studies have shown that children whose mothers received prenatal oral health care had delayed S. mutans colonization and a lower carriage than those whose mother did not receive oral health care during pregnancy [ 28 , 29 , 30 ], changes of S. mutans in the oral cavity of the mothers upon receiving prenatal oral health care are have not been assessed.…”

Opportunist Coinfections by Nontuberculous Mycobacteria and Fungi in Immunocompromised Patients

“…Fungi have frequently caused diseases in immunocompromised patients with HIV, cancer, diabetes and patients treated with immunosuppressive drugs [12][13][14][15][16][17]. In a separate category are healthy individuals with flaws in the immune system due to age (children and elderly), antibiotic treatment or pregnancy [18][19][20][21]. In addition to common diseases, fungi can cause very serious life-threatening infections [14,16,22,23].…”