Optimizing T4 DNA Polymerase Conditions Enhances the Efficiency of One-Step Sequence- and Cligation-Independent Cloning

Abstract

Previously, we developed a one-step sequence- and ligation-independent cloning (SLIC) method that is simple, fast, and cost-effective. However, although one-step SLIC generally works well, its cloning efficiency is occasionally poor, potentially due to formation of stable secondary structures within the single-stranded DNA (ssDNA) region generated by T4 DNA polymerase during the 2.5 min treatment at room temperature. To overcome this problem, we developed a modified thermo-regulated one-step SLIC approach by testing shorter T4 DNA polymerase treatment durations (5 s-2.5 min) over a wide range of temperatures (25-75°C). The highest cloning efficiency resulted when inserts with homology lengths <20 bases were treated with T4 DNA polymerase for 30 s at 50°C. This briefer T4 polymerase treatment at a higher temperature helps increase cloning efficiency for inserts with strong secondary structures at their ends, increasing the utility of one-step SLIC for the cloning of short fragments.

Middle East Respiratory Syndrome Coronavirus-Encoded Accessory Proteins Impair MDA5-and TBK1-Mediated Activation of NF-��B

“…Multiple cloning site (MCS) of pcDNA3.1-Hygro(+) vector was modified with the following sequences (5'-GCTAGCGCCACC ATGTACCCATACGACGTCCCAGACTACGCTAAGCTTTCTGGT GGCGGTGGCTCGGGCGGAGGTGGGTCGGGTGGCGGCGGAT CCTGCAGGCGCGCCAGCGCTATCGATATCGATGGCGCCTGGC CAGACCATCAGTCGAGTGGCGCCACTGGACTAATGGTCCGTA CGCTCGACTGTACAGGCCGGCCTCAGGTTAACACCGGTACCT CAGCCCGGGCGGCCGCATGCGGGCCCCTCGAGTCTAGAGTTT AAAC-3) to generate a Hygro-JY4-HAN-GS3 (HA-tag and a spacer (3X GGGGS) at the N-terminus of the modified MCS) vector. The modified vector, named pcDNA3.1-Hygro-JY4-HAN-GS3, was provided for sequence-dependent ligation independent cloning (SLIC) [27,28]. MDA5, RIG-I, MAVS, IKKε, TBK1 and IRF3 were amplified using primers listed in Table 2.…”

Middle East respiratory syndrome coronavirus-encoded ORF8b strongly antagonizes IFN-β promoter activation: its implication for vaccine design

“…Multiple cloning site (MCS) of an expression vector, pcDNA-3.1-Hygro(+) (Lee et al, 2018), was modified with a linker DNA to generate an HA-tagged Neo-JY4 vector: 5 -GCTA GCGCCACCATGTACCCATACGACGTCCCAGACTAC GCTAAGCTTTCTGGTGGCGGTGGCTCGGGCGGAG GTGGGTCGGGTGGCGGCGGATCCTGCAGGCGCGC CAGCGCTATCGATATCGATGGCGCCTGGCCAGACC ATCAGTCGAGTGGCGCCACTGGACTAATGGTCCGT ACGCTCGACTGTACAGGCCGGCCTCAGGTTAACAC CGGTACCTCAGCCCGGGCGGCCGCATGCGGGCCC CTCGAGTCTAGAGTTTAAAC-3 . The modified vector, named pcDNA3.1-Hygro-JY4-HAN-GS3 harboring a HA tag and a spacer (3xGGGGS) at the N-terminus of MCS, was used to clone immune genes (see text) by employing sequence and ligation independent cloning (SLIC) (Jeong et al, 2012;Islam et al, 2017). MDA5, RIG-I, MAVS, IKKε, TBK1, and IRF3 were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB): 98°C for 10 sec, 58°C for 30 sec, 72°C for 30 sec/kb for 30 cycles.…”

Homologous alignment cloning: a rapid, flexible and highly efficient general molecular cloning method

“…In order to assert the benefits of our method amongst the different variations of LIC-based methods in the literature, we chose to perform a direct comparison of HAC with the one-step SLIC method ( Islam et al, 2017 ; Jeong et al, 2012 ). The one-step SLIC was first described as an improvement and simplification of the original SLIC method, which while it was the earliest description of a LIC method without sequence restriction, it was also a somewhat complicated procedure ( Li & Elledge, 2007 ).…”

“…A number of other LIC methods have since been proposed, and these include the sequence and ligation-independent cloning (SLIC) ( Li & Elledge, 2007 ), polymerase incomplete primer extension (PIPE) cloning ( Klock et al, 2008 ), overlap extension cloning (OEC) ( Bryksin & Matsumura, 2010 ), FastCloning ( Li et al, 2011 ), quick and clean cloning ( Thieme et al, 2011 ), exonuclease and ligation-independent cloning (ELIC) ( Koskela & Frey, 2015 ), and one-step SLIC ( Islam et al, 2017 ; Jeong et al, 2012 ). Among these methods, the SLIC, PIPE and OEC have been tested and discussed in an independent study raising their merits and limitations ( Stevenson et al, 2013 ).…”

“…Among these methods, the SLIC, PIPE and OEC have been tested and discussed in an independent study raising their merits and limitations ( Stevenson et al, 2013 ). While ELIC claims to be the fastest of all LIC methods, the reliability of this procedure has been called into question ( Islam et al, 2017 ).…”