Optimizing nucleic acid extraction from thyroid fine-needle aspiration cells in stained slides, formalin-fixed/paraffin-embedded tissues, and long-term stored blood samples

Abstract

Objective: Adequate isolation of nucleic acids from peripheral blood, fine-needle aspiration cells in stained slides, and fresh and formalin-fixed/paraffin-embedded tissues is crucial to ensure the success of molecular endocrinology techniques, especially when samples are stored for long periods, or when no other samples can be collected from patients who are lost to follow-up. Here, we evaluate several procedures to improve current methodologies for DNA (salting-out) and RNA isolation. Materials and methods: We used proteinase K treatment, heat shock, and other adaptations to increase the amount and quality of the material retrieved from the samples. Results: We successfully isolated DNA and RNA from the samples described above, and this material was suitable for PCR, methylation profiling, real-time PCR and DNA sequencing. Conclusion: The techniques herein applied to isolate nucleic acids allowed further reliable molecular analyses. Arq Bras Endocrinol Metab. 2012;56(9):618-26 Keywords DNA; RNA; nucleic acid extraction; FNA; FFPE tissue; blood RESUMO Objetivo: O isolamento adequado de ácidos nucleicos a partir de sangue periférico, lâmina corada de punção aspirativa por agulha fina, tecido fixado em formalina e emblocado em parafina e tecido fresco é fundamental para assegurar o sucesso de técnicas aplicadas em endocrinologia molecular, principalmente quando lidamos com amostras estocadas por longos períodos ou quando há impossibilidade de nova coleta de amostra de pacientes que perderam o seguimento. Neste trabalho, objetivamos otimizar as metodologias clássicas para a extração de DNA (salting-out) e RNA. Materiais e métodos: Utilizamos proteinase K, choque térmico, dentre outras modificações, com o objetivo de aumentar a quantidade e a qualidade do material recuperado a partir das amostras descritas acima. Resultados: Isolamos com sucesso DNA e RNA de tais amostras e o material obtido foi adequado para a realização de PCR, perfil de metilação, PCR em tempo real e sequenciamento de DNA. Conclusão: As técnicas aplicadas neste estudo para isolar ácidos nucleicos permitiram a realização posterior de análises moleculares consistentes e confiáveis. Arq Bras Endocrinol Metab. 2012;56(9):618-26 Descritores

A novel GNRHR gene mutation causing congenital hypogonadotrophic hypogonadism in a Brazilian kindred

“…To confirm the alleged variants identified by the massive parallel sequencing, we designed primers to amplify each region and performed a classical Sanger sequencing as described previously . GNRHR (5′‐ACTTTGGCAGAAATAAGAGCACTA‐3′ and 5′‐TTGAGGCTCTGAAGACTGAGTT‐3′) and SEMA3A (5′‐TGAAGGCGTATATTCCATGAGT‐3′ and 5′‐AATATCTGTCTGTAGCTGCATTGTT‐3′) primers were used for a polymerase chain reaction (PCR) according to the conditions: 5 minutes at 95°C, 38 cycles of 45 seconds at 95°C, 45 seconds for annealing and 1 minute at 72°C, and a final elongation step for 10 minutes at 72°C.…”

Molecular cloning of ion channels inFelis catusthat are related to periodic paralyses in man: a contribution to the understanding of the genetic susceptibility to feline neck ventroflexion and paralysis

“…We enrolled 11 cats presented to Clinical Veterinary of Small Animal in São Paulo. DNA extraction was performed using a salting-out procedure according to an in-house method, as reported by Kizys et al (Kizys et al, 2012). …”

Unexpected finding of a whole HNF1B gene deletion during the screening of rare MODY types in a series of Brazilian patients negative for GCK and HNF1A mutations

“…Genomic DNA was extracted from blood leucocytes using inhouse methodology as previously described [12]. Genetic analysis of GCK and HNF1A by Sanger Sequencing was performed as previously described [10].…”