One-Step Sequence- and Ligation-Independent Cloning as a Rapid and Versatile Cloning Method for Functional Genomics Studies

Abstract

bWe developed one-step sequence-and ligation-independent cloning (SLIC) as a simple, cost-effective, time-saving, and versatile cloning method. Highly efficient and directional cloning can be achieved by direct bacterial transformation 2.5 min after mixing any linearized vector, an insert(s) prepared by PCR, and T4 DNA polymerase in a tube at room temperature.T he need for high-throughput recombinant DNA technology is rising because of the rapid increase in interest in functional genomic studies following the surge of data generated by nextgeneration sequencing. Construction of a library or conversion of an existing library into a different context requires a highthroughput gene cloning method, but conventional methods suffer from high cost, prolonged manipulation, or sequence restriction.Ligation-independent cloning (LIC) is based on the 3=-to-5= exonuclease activity of T4 DNA polymerase and has been used for 2 decades as a high-throughput method due to its uniformity and cost-effectiveness but requires a specifically designed vector containing a long stretch of sequence that lacks a particular deoxynucleoside triphosphate (1,(3)(4)(5)(6)9). Sequence-and ligation-independent cloning (SLIC) overcomes the sequence restraint of LIC and allows the assembly of multiple overlapping fragments simultaneously, but the cloning efficiency of SLIC in the absence of RecA is rather low (10). Various recombinase-based cloning methods, including Gateway cloning (Invitrogen), Cre-lox recombination, Red/ET recombination (Gene Bridges), In-Fusion (Clontech), Cold Fusion (System Biosciences), and CloneEZ (GenScript), have been developed, but the general use of these methods has been hampered by high cost and restrictions in the sequence or hosts (2, 12-15).We have optimized SLIC to make it comparable to commercial methods in terms of simplicity, time saving, and cloning efficiency. One-step SLIC utilizes only T4 DNA polymerase but shows cloning efficiencies similar to those of the original SLIC method in the presence of RecA and of commercial methods. An overview of one-step SLIC is illustrated in Fig. 1A. First, the vector needs to be linearized by either restriction enzyme digestion or inverse PCR. An insert(s) is prepared by PCR with primers with a 15-bp or longer extension homologous to each end of the linearized vector. Second, the vector and insert(s) are mixed and incubated at room temperature for 2.5 min with T4 DNA polymerase to generate 5= overhangs. For optimal results, a 1:2 to 1:4 molar vector-to-insert ratio is desirable. Third, the reaction mixture is placed on ice for 10 min for single-strand annealing and then competent Escherichia coli cells are transformed with the annealed DNA complex directly. The annealed complex turns into seamless recombinant DNA through homologous recombination in vivo with high efficiency. For a detailed description of the method, see the supplemental material.pUC118-HMG (11) was cleaved with BamHI, and a 1-kb insert containing Ton_0709 from the genomic DNA of Thermococcus onnurineus NA1 ...

PhoU Allows Rapid Adaptation to High Phosphate Concentrations by Modulating PstSCAB Transport Rate in Sinorhizobium meliloti

“…Where necessary, plasmids were mobilized with the E. coli MT616 helper strain (47). Unless stated otherwise, cloning of DNA fragments into plasmids was performed with sequence-and ligation-independent cloning (SLIC) (48). Oligonucleotide sequences used in this study are listed in Table S2.…”

S5H/DMR6 Encodes a Salicylic Acid 5-Hydroxylase That Fine-Tunes Salicylic Acid Homeostasis

“…The 2.4-kb S5H/DMR6 promoter was amplified with S5H-P1 (59-GCAGGCTCCGAATTCTCCCAAACCATGATGGCACC-39) and S5H-P2 (59-AAGCTGGGTCGAATTCCAGAAAATTGAAGAAGAATC-39) primers and cloned into the Gateway entry vector pCR8 (Thermo Fisher Scientific) via the sequence-and-ligation-independent cloning method (Jeong et al, 2012) to form pCR8-S5Hpro. The S5H/DMR6 promoter in pCR8-S5Hpro was introduced into pMDC163 via LR reactions to construct S5Hpro::GUS binary vectors.…”

A Pseudomonas aeruginosa TIR effector mediates immune evasion by targeting UBAP1 and TLR adaptors

“…PSPA7_2375 gene was amplified with an artificial Shine‐Dalgarno (AAGAAG) and cloned into mini‐CTX‐P BAD digested by Spe I/ Sac I using the SLIC method (Jeong et al , 2012). Primers used were 5′‐AGCCCGGGGGATCCACTAGTAGGAGGTGAGATATACAATGGCGGTCTTCATTAGTTA‐3′ and 5′‐ACCATCCAGTGCAGGAGCTCCTATGCGCGCGGCCACGGG‐3′.…”

“…DNA product was then cloned by the SLIC method (Jeong et al , 2012) into pKNG208 (Cadoret et al , 2014) digested by Apa I/ Spe I to generate pKNG208‐ pumA::bla1 vector.…”