One-Step Fabrication of Bone Morphogenetic Protein-2 Gene-Activated Porous Poly-L-Lactide Scaffold for Bone Induction

Abstract

Bone morphogenetic protein 2 (BMP2) is an efficacious inducer for the osteogenesis of mesenchymal stem cells (MSCs). Conventional applications of BMP2 have involved either the direct incorporation of BMP2 protein or ex vivo BMP2 gene transfer into stem cells prior to their transplantation. These approaches are able to promote bone formation to some extent; however, they are hampered by either the lack of stability and sustainability of BMP2 protein or the time-consuming and cost-prohibitive in vitro cell culture procedure. To overcome these limitations, we have developed a gene-activated poly-L-lactide acid (PLLA) scaffold with the encapsulation of recombinant adeno-associated viral (AAV) vector encoding a full-length cDNA of human BMP2 using an ice-based microparticle porogenization method that was recently developed. Results showed continuous release of AAV particles from the micropores of scaffolds for up to 1 week, subsequently transducing embedded human MSCs and producing functional BMP2. MSCs within scaffolds underwent efficacious osteogenesis, on the basis of osteoinductive gene expression and osteogenic differentiation, which resulted in robust new bone formation in vivo at 4 weeks. These findings show the potential of the technology toward developing clinical applications of a rapid, cost-effective, and potentially point-of-care approach for the repair of bone defects.

Injectable BMP-2 gene-activated scaffold for the repair of cranial bone defect in mice

“…The hBMSCs were isolated as previously described 11,14,16,17 and cultured in proliferation medium (PM) (GM; α‐MEM +1% Antibiotic‐Antimycotic +10% fetal bovine serum [FBS]; Gibco/Life Technologies, Grand Island, New York) and 1 ng/mL Fibroblast Growth Factor 2 (FGF‐2, R&D Systems, Minneapolis, Minnesota), the hBMSCs were then plated into T150 tissue culture flasks and cultured in 37°C with 5% CO 2 . The nonadherent cells were washed by phosphate‐buffered saline after 3 days culture, and GM were changed every 3 days.…”

“…The primer sequences for osteocalcin (OCN) and alkaline phosphatase (ALP) were as follows: forward, 5′‐TGACGAGTTGGCTGACCA‐3′ and reverse, 5′‐AGGGTGCCTGGAGAGGAG‐3′; forward, 5′‐GACCTCCTCGGAAGACACTC‐3′ and reverse, 5′‐TGAAGGGCTTCTTGTCTGTG‐3′, respectively. The results were analyzed using the comparative CT method according to our published protocol 14 …”

“…Based on high efficiency of serotype 6 of rAAV vector in hBMSCs, 14 it was selected for all subsequent in vitro and in vivo experiments. Because controlled release of viral particles from the gene‐activated VL‐PXL fabricated 3D gelatin scaffold is critical to the success of gene transduction of the seeded hBMSCs, dot blot assay was performed to assess the kinetics of viral release from the mGL scaffold.…”

“…In previous studies, viral vectors have been demonstrated to be an effective and safe BMP‐2 gene delivery vehicle through in vivo 12 and ex vivo 13 gene therapy. We used recombinant adeno‐associated viral (rAAV) as the delivery vehicle to transduce human BMP‐2 gene into hBMSCs through a single step procedure that skips in vitro preparation time 14 . Expression of BMP‐2 gene was determined by enzyme‐linked immunosorbent assay (ELISA) assay.…”

Reverse transduction can improve efficiency of AAV vectors in transduction‐resistant cells

“…Bone morphogenetic protein‐2 (BMP2)‐expressing AAV2 has also been coated onto hydroxyapatite in a similar fashion and demonstrated to induce bone formation in a rat model (Nasu et al, ). More recently, a group generated poly( l ‐lactic acid) scaffolds incorporating AAV encoding BMP2 and evaluated the osteogenic potential in vitro and in vivo with seeded human mesenchymal stem cells (hMSCs) (Xue et al, ). Despite encouraging outcomes seen from the aforementioned examples, some studies have also reported low transduction efficiencies.…”