One fly - one genome : Chromosome-scale genome assembly of a single outbred <i>Drosophila melanogaster</i>

Adams, Matthew S.; McBroome, Jakob; Maurer, Nicholas; Pepper-Tunick, Evan; Saremi, Nedda F.; Green, Edward; Vollmers, Christopher; Corbett-Detig, Russell

doi:10.1101/866988

Cited by 8 publications

(9 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Additional details of sample collection are provided in the Methods . Future work to improve biological and taxonomic diversity, particularly for species difficult to culture, should employ single fly sequencing and assembly workflows (Adams et al, 2020).…”

Section: Resultsmentioning

confidence: 99%

Highly contiguous assemblies of 101 drosophilid genomes

Kim

Wang

Miller

et al. 2020

Preprint

View full text Add to dashboard Cite

Over 100 years of studies in Drosophila melanogaster and related species in the genus Drosophila have facilitated key discoveries in genetics, genomics, and evolution. While high-quality genome assemblies exist for several species in this group, they only encompass a small fraction of the genus. Recent advances in long read sequencing allow high quality genome assemblies for tens or even hundreds of species to be generated. Here, we utilize Oxford Nanopore sequencing to build an open community resource of high-quality assemblies for 101 lines of 95 drosophilid species encompassing 14 species groups and 35 sub-groups with an average contig N50 of 10.5 Mb and greater than 97% BUSCO completeness in 97/101 assemblies. These assemblies, along with detailed wet lab protocol and assembly pipelines, are released as a public resource and will serve as a starting point for addressing broad questions of genetics, ecology, and evolution within this key group.

show abstract

Section: Resultsmentioning

confidence: 99%

Highly contiguous assemblies of 101 drosophilid genomes

Kim

Wang

Miller

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…We also calculated median accuracy and number of detected species using the R2C2 (Rolling Circle Amplification to Concatemeric Consensus) post-processing pipeline C3POa (Concatemeric Consensus Caller using partial order alignments) for consensus calling (Volden et al 2018). C3POa generates two kinds of output reads: 1) Consensus reads if the raw read is sufficiently long to cover an insert sequence more than once and 2) Regular "1D" reads if no splint sequence could be detected in the raw read (Adams et al 2019). We only used consensus reads for downstream analysis.…”

Section: Metabarcoding Using Nanopore Sequencingmentioning

confidence: 99%

A workflow for accurate metabarcoding using nanopore MinION sequencing

et al. 2021

View full text Add to dashboard Cite

Metabarcoding has become a common approach to the rapid identification of the species composition in a mixed sample. The majority of studies use established short‐read high‐throughput sequencing platforms. The Oxford Nanopore MinIONTM, a portable sequencing platform, represents a low‐cost alternative allowing researchers to generate sequence data in the field. However, a major drawback is the high raw read error rate that can range from 10% to 22%. To test whether the MinIONTM represents a viable alternative to other sequencing platforms, we used rolling circle amplification (RCA) to generate full‐length consensus DNA barcodes for a bulk mock sample of 50 aquatic invertebrate species with at least 15% genetic distance to each other. By applying two different laboratory protocols, we generated two MinIONTM runs that were used to build error‐corrected consensus sequences. A newly developed Python pipeline, ASHURE, was used for data processing, consensus building, clustering and taxonomic assignment of the resulting reads. Our pipeline achieved median accuracies of up to 99.3% for long concatemeric reads (>45 barcodes) and successfully identified all 50 species in the mock community. The use of RCA was integral for increasing consensus accuracy but was also the most time‐consuming step of the laboratory workflow. Most concatemeric reads were skewed towards a shorter read length range with a median read length of up to 1,262 bp. Our study demonstrates that Nanopore sequencing can be used for metabarcoding, but exploration of other isothermal amplification procedures to improve consensus accuracy is recommended.

show abstract

“…In this step the original long amplicons were transformed into long concatemers with multiple copies of each long molecule. Next, unlike other studies 22,23 , we applied 60 units warm-started Bst 2.0 polymerase (NEB, M0538M) and primer extension with specific sequences (CGCTGATAAGGTCGCCATGCCTCTCAGTAC) to generate the second strand of the RCR product ready for standard stLFR library preparation.…”

Section: Circularization and Rolling Circle Replicationmentioning

confidence: 99%

“…The gap harbors transfer RNA (tRNA) genes (Supplementary figure 2), which may be a target for cleavage by the Tn5 transposase, the enzyme used for fragmentation during sequencing library preparation [16][17][18][19] . Although cleavage by the Tn5 transposase exhibits limited sequence bias, target preferences might still exist and cause the failure of effectively retrieving fragments covering the entire rDNA gene region [22][23][24] . In eukaryotes, tRNA genes are generally located outside the SSU and LSU regions, not in-between, which may at least in part explain why the eukaryotic amplicons survived, but the bacterial amplicons were split.…”

mentioning

confidence: 99%

High-resolution single-molecule long-fragment rRNA gene amplicon sequencing for uncultured bacterial and fungal communities

Fang

Fan

et al. 2021

Preprint

View full text Add to dashboard Cite

Although several large-scale environmental microbial projects have been initiated in the past two decades, understanding of the role of complex microbiotas is still constrained by problems of detecting and identifying unknown microorganisms1-6. Currently, hypervariable regions of rRNA genes as well as internal transcribed spacer regions are broadly used to identify bacteria and fungi within complex communities7, 8, but taxonomic and phylogenetic resolution is hampered by insufficient sequencing length9-11. Direct sequencing of full length rRNA genes is currently limited by read length using second generation sequencing or sacrificed quality and throughput by using single molecule sequencing. We developed a novel method to sequence and assemble nearly full length rRNA genes using second generation sequencing. Benchmarking was performed on mock bacterial and fungal communities as well as two forest soil samples. The majority of rRNA gene sequences of all species in the mock community samples were successfully recovered with identities above 99.5% compared to the reference sequences. For soil samples we obtained exquisite coverage with identification of a large number of putative new species, as well as high abundance correlation between replicates. This approach provides a cost-effective method for obtaining extensive and accurate information on complex environmental microbial communities.

show abstract

One fly - one genome : Chromosome-scale genome assembly of a single outbred Drosophila melanogaster

Cited by 8 publications

References 44 publications

Highly contiguous assemblies of 101 drosophilid genomes

Highly contiguous assemblies of 101 drosophilid genomes

A workflow for accurate metabarcoding using nanopore MinION sequencing

High-resolution single-molecule long-fragment rRNA gene amplicon sequencing for uncultured bacterial and fungal communities

Contact Info

Product

Resources

About