OligoMinerApp: a web-server application for the design of genome-scale oligonucleotide in situ hybridization probes through the flexible OligoMiner environment

Abstract

Fluorescence in situ hybridization (FISH) is a powerful single-cell technique that harnesses nucleic acid base pairing to detect the abundance and positioning of cellular RNA and DNA molecules in fixed samples. Recent technology development has paved the way to the construction of FISH probes entirely from synthetic oligonucleotides (oligos), allowing the optimization of thermodynamic properties together with the opportunity to design probes against any sequenced genome. However, comparatively little progress has been made in the development of computational tools to facilitate the oligos design, and even less has been done to extend their accessibility. OligoMiner is an open-source and modular pipeline written in Python that introduces a novel method of assessing probe specificity that employs supervised machine learning to predict probe binding specificity from genome-scale sequence alignment information. However, its use is restricted to only those people who are confident with command line interfaces because it lacks a Graphical User Interface (GUI), potentially cutting out many researchers from this technology. Here, we present OligoMinerApp (http://oligominerapp.org), a web-based application that aims to extend the OligoMiner framework through the implementation of a smart and easy-to-use GUI and the introduction of new functionalities specially designed to make effective probe mining available to everyone.

CCN1 interacts with integrins to regulate intestinal stem cell proliferation and differentiation

“…Oligonucleotide probe for Ccn1 (5’- CTGCGGCTGCTGTAAGGTCTGCGCTAAACAACTCAA -3’) was designed using OligoMinerApp ( http://oligominerapp.org ) 79 and synthesized with 3’ Alexa Fluor 546 conjugation from Integrated DNA Technologies (IDT, Iowa). The probe was prepared at 100 nM working concentration in saline sodium citrate (SSC, pH 4.5) hybridization buffer containing 10% formamide and BSA (1 mg per ml), denatured at 65 °C for 10 min, and kept on ice before hybridization.…”

PaintSHOP enables the interactive design of transcriptome- and genome-scale oligonucleotide FISH experiments

“…The computational design of an oligo-based RNA or DNA FISH experiment consists of two distinct phases. In the first phase, the sequence of a genome assembly is processed by a probe discovery algorithm such as OligoArray 14 , 32 , 35 , the Perl-based OligoPicker used to generate the iFISH probe database 34 , the command-line version of OligoMiner 33 , or the web-based OligoMinerApp 36 that wraps the OligoMiner scripts into a graphical user interface to identify probe sequences with specified thermodynamic properties that are predicted to be specific ( Fig. 1a and Supplementary Table 1 ).…”

Probe-Seq: Method for RNA Sequencing of Specific Cell Types from Animal Tissue

“…Adapted from the original protocols on Primer Exchange Reaction and SABER (Kishi et al, 2018 and (Passaro et al, 2020). The website can be accessed here: http://oligominerapp.org/home.…”