Oligomeric State and Thermal Stability of Apo- and Holo- Human Ornithine δ-Aminotransferase

Abstract

Human ornithine δ-aminotransferase (hOAT) (EC 2.6.1.13) is a mitochondrial pyridoxal 5′-phosphate (PLP)-dependent aminotransferase whose deficit is associated with gyrate atrophy, a rare autosomal recessive disorder causing progressive blindness and chorioretinal degeneration. Here, both the apo- and holo-form of recombinant hOAT were characterized by means of spectroscopic, kinetic, chromatographic and computational techniques. The results indicate that apo and holo-hOAT (a) show a similar tertiary structure, even if apo displays a more pronounced exposure of hydrophobic patches, (b) exhibit a tetrameric structure with a tetramer-dimer equilibrium dissociation constant about fivefold higher for the apoform with respect to the holoform, and (c) have apparent Tm values of 46 and 67 °C, respectively. Moreover, unlike holo-hOAT, apo-hOAT is prone to unfolding and aggregation under physiological conditions. We also identified Arg217 as an important hot-spot at the dimer–dimer interface of hOAT and demonstrated that the artificial dimeric variant R217A exhibits spectroscopic properties, Tm values and catalytic features similar to those of the tetrameric species. This finding indicates that the catalytic unit of hOAT is the dimer. However, under physiological conditions the apo-tetramer is slightly less prone to unfolding and aggregation than the apo-dimer. The possible implications of the data for the intracellular stability and regulation of hOAT are discussed.Electronic supplementary materialThe online version of this article (doi:10.1007/s10930-017-9710-5) contains supplementary material, which is available to authorized users.

Ornithine δ‐aminotransferase is critical for floret development and seed setting through mediating nitrogen reutilization in rice

“…Ornithine d-aminotransferase (dOAT) is an important enzyme in both arginine and proline metabolisms. It is a pyridoxal 5 0 -phosphate PLP-dependent enzyme that catalyzes d-transamination of L-ornithine (L-Orn) and a-ketoglutarate (AKG) to glutamic-c-semialdehyde (GSA) and L-glutamate (Montioli et al, 2017). dOAT inhibits neurogenesis during Xenopus embryonic development (Peng et al, 2015).…”

R180T variant of δ‐ornithine aminotransferase associated with gyrate atrophy: biochemical, computational, X‐ray and NMR studies provide insight into its catalytic features

“…The altered state of the bound coenzyme and of its microenvironment is corroborated by the fact that we were not able to obtain the apo form of the mutant. In fact, upon reaction of the R180T mutant with phenylhydrazine under the same experimental conditions already used for the wild‐type OAT , no PLP release occurs. The same result was obtained when, instead of phenylhydrazine, hydroxylamine was used.…”

“…Structure of the R180T mutant. (A) Structural superposition of the OAT ‐R180T mutant (the two chains of the dimer are shown in brown and yellow) and OAT wild‐type (in green; PDB : 1OAT; ). The two structures superpose with a r.m.s.d.…”

“…Dashed lines indicate the key interaction of R180, T180 and of the FMP inhibitor. (E) Superposition of the mutant (in brown and yellow), wild‐type (in green; PDB : 1OAT; ) and FMP bound (in white; PDB : 2OAT; ) structures showing the different conformation of the main chain in the region of the partner subunit 319 HGS 321 . The Cα of Gly320′ are shifted of 1.4 Å.…”

“…Site‐directed mutagenesis was performed by means of the QuikChange II site‐directed mutagenesis kit (Agilent Technologies, Santa Clara, California) using pOAT as templates. The pathogenic mutation R180T was introduced by using the primer 5′‐GGGAACTTCTGGGGTACGACGTTGTCTGCTATC‐3′ and its complement (the mutated codon is underlined).…”