Odorant‐binding protein 19 in Monochamus alternatus involved in the recognition of a volatile strongly emitted from ovipositing host pines

Abstract

Monochamus alternatus is the primary carrier of pine wood nematodes, which pose a serious threat to Pinus spp. in many countries. Newly emerging M. alternatus adults feed on heathy host pines, while matured adults transfer to stressed host pines for mating and oviposition. Several odorant‐binding proteins (OBPs) of M. alternatus have been proved to aid in the complex process of host location. To clarify the corresponding relations between OBPs and pine volatiles, more OBPs need to be studied. In this research, MaltOBP19 showed a specific expression in the antennae and mouthparts of M. alternatus, and it was marked in 4 types of antenna sensilla by immunolocalization. Fluorescence binding assays demonstrated the high binding affinity of MaltOBP19 with camphene and myrcene in vitro. In Y‐tube olfactory experiments, M. alternatus adults were attracted by camphene and RNAi of OBP19 via microinjection significantly decreased their attraction index. Myrcene induced phobotaxis, but RNAi had no significant effect on this behavior. Further, we found that ingesting dsOBP19 produced by a bacteria‐expressed system with a newly constructed vector could lead to the knockdown of MaltOBP19. These results suggest that MaltOBP19 may play a role in the process of host conversion via the recognition of camphene, which has been identified to be strongly released in stressed host pines. In addition, it is proved that knockdown of OBP can be achieved by oral administration of bacteria‐expressed double‐stranded RNA in M. alternatus adults, providing a new perspective in the control of M. alternatus.

Identification of odorant‐binding proteins and functional analysis of antenna‐specific BhorOBP28 in Batocera horsfieldi (Hope)

“…S8). The bacteria producing dsGFP was from the same culture used previously by Yang et al 47 . As expected, a significant reduction in the transcript of BhorOBP28 occurred in the dsBhorOBP28 feeding treatment, with 71.54% decrease compared with the dsGFP feeding treatment on the 6th day (Fig.…”

“…dsRNA was generated using a specific RNase III‐deficient Escherichia coli strain. The fragment of the BhorOBP28 gene and the complete GFP gene were designed to homologous recombine with linearized L4440‐cp25 modified plasmids as described previously 47 . The fragment of BhorOBP28 was cloned by PCR using specific primers as follows: dsBhorOBP28‐F, GGTACCGGGCCCCCCCTCGAGCGCGTACTCAGCGTTTACAG, dsBhorOBP28‐R, GGCAGATCTGATATCAAGCTTGGGTCGCCAATACTAGGTGG.…”

Binding Properties of Odorant Binding Protein 37 in Plagiodera versicolora to Host Volatile, o-Cymene

“…The functional research of OBPs is mostly focused on the Lepidoptera. Recently, reports about Coleoptera have gradually increased, such as CjapOBP1 and CjapOBP2 in Cybister japonicus (Coleoptera: Dytiscidae), HparOBP3 in Holotrichia parallela (Coleoptera: Melolonthidae), MaltOBP19 in Monochamus alternatus (Coleoptera: Cerambycidae), and so on. However, the olfactory mechanism of OBPs in P.…”

Gustatory Receptor 206 Participates in the Foraging Behavior of Larvae of Polyphagous Pest Spodoptera litura

“…For example, oral dsBgCHS1 and dsBgCHS2 delivery have been found to lead to high mortality and ultrastructural changes in the integument and midgut of Blattella germanica nymphs. 47 In addition, OBP can be knocked down by the oral administration of bacterial dsRNA in Monochamus alternatus adults, 48 and five immune genes of Plagiodera versicolora can be silenced by feeding dsRNA-expressing bacteria. 49 In the present study, a large-scale dsRNA production system was constructed using E. coli.…”