Occupancy of Upstream Regulatory Sites In Vivo Coincides with Major Histocompatibility Complex Class I Gene Expression in Mouse Tissues

Abstract

The major histocompatibility complex (MHC) class I HLA-B7 transgene carrying a 660-bp upstream sequence is expressed in the mouse with tissue specificity that parallels that of the expression of endogenous mouse MHC class I (H-2) genes. We have performed in vivo genomic footprinting for the HLA-B7 transgene and the endogenous H-2Kb gene. We show that the upstream region of both the transgene and the endogenous gene was extensively occupied in spleen tissue, where these genes are expressed at high levels. In contrast, no occupancy was detected in brain tissue, where expression of these genes is virtually absent. Sites exhibiting in vivo protection correspond to cis elements previously shown to bind to nuclear factors in vitro, including the constitutive enhancer region I and the interferon response element. The strongest tissue-specific protection was detected at site alpha, located downstream from the interferon response element. Site alpha bound a constitutively expressed nuclear factor(s) in vitro that exhibited an overlapping specificity which may involve a nuclear hormone receptor, RXR, and an AP-1-related factor. Site alpha was functional in vivo, as it enhanced MHC class I transcription in lymphocytes. These results show that the tissue-specific occupancy of the MHC class I regulatory sequences in vivo correlates with their expression and suggest that in vivo occupancy is controlled by a mechanism other than the mere presence of factors capable of binding to these sites. Our results suggest that a sequence present in the 660-bp upstream region in a human leukocyte antigen gene directs tissue-specific occupancy of MHC class I genes in vivo, independently of their position and copy number, illustrating a potential advantage of using a transgene for delimitation of the sequence requirement for in vivo occupancy.

The cyclin B1 gene is actively transcribed during mitosis in HeLa cells

“…To test whether the open chromatin structure leads to transcription factor–DNA interactions, we performed in vivo genomic footprinting of the cyclin B1 promoter during mitosis. Asynchronous and mitotic cells were treated with the DNA alkylating reagent dimethyl sulfate (DMS), and methylated G residues were identified using the ligation‐mediated polymerase chain reaction technique (LM–PCR) (Dey et al ., 1992). In asynchronous cells, four regions on the cyclin B1 promoter non‐coding strand were hypersensitive to or protected from DMS methylation: the E box (−124 to −119 bp), the GC box (−80 to −71 bp), the upstream CCAAT box (−17 to −12 bp) and the downstream CCAAT box (+15 to +20 bp) (Figure 3, lane 2).…”

“…The in vivo DNA footprinting was performed using LM–PCR as described previously (Dey et al ., 1992). For cyclin B1 , the following oligonucleotides were used: first primer, TGGCATTGGCAACGCACAC ( T m = 54°C); second primer, ACTGGCTTCACTTGCTCTCCAGGTGCGCTG ( T m = 63°C); third primer, CATGGCTTCCTCTTCACCAGG ( T m = 69°C).…”