Nucleotide Variations in theNPHS2Gene in Greek Children with Steroid-Resistant Nephrotic Syndrome

Abstract

Mutations in the NPHS2 gene, encoding podocin, are a major cause of autosomal-recessive steroid-resistant nephrotic syndrome (SRNS) in childhood, accounting for up to 30% of sporadic and 20-40% of familial cases. Among 22 Greek children with a clinical diagnosis of SRNS, mutation analysis was performed in all eight NPHS2 gene exons, using denaturing gradient gel electrophoresis and DNA sequencing. The frequency of all nucleotide variations found in patients was also evaluated in 100 unrelated samples (18-30 years) with no known history of nephrotic disease. Three pathogenic genotypes (R138Q/R138Q, R229Q/A295T, and R168H/R168H) accounted for 3/14 (21%) of sporadic patients; the A295T mutation in exon 8 (c.883G>A) is novel and predicted in silico to be pathogenic. Among the familial cases, a single patient was heterozygous for R229Q. Several known polymorphisms were found, including the in cis variants IVS3-46C>T plus IVS3-21C>T, IVS7+7A>G A and exonic variants S96S (c.288C>T), A318A (c.954T>C), and L346L (c.1038A>G), with allele frequencies comparable to those in other populations. A novel substitution (IVS3-17C>T) was found in two related patients, but in no controls. In conclusion, podocin mutations do not appear to be a major cause of SRNS in Greek children, although the study cohort was small. However, NPHS2 gene analysis could still be considered in Greek SRNS patients to support appropriate management. The present study also contributes potentially useful observations for the clinical management of SRNS patients.

Broad and unexpected phenotypic expression in Greek children with steroid-resistant nephrotic syndrome due to mutations in the Wilms’ tumor 1 (WT1) gene

“…Overall, in 27 SRNS patients we have studied so far, four patients were identified with causative WT1 mutations (15%), representing a high percentage but the cohort is small. In our cohort, none of the patients previously diagnosed with NPHS2 pathological variations were found to have mutations in the WT1 gene [30]. The majority of the patients reported to date with SRNS and WT1 mutations have been phenotypically females; 46XY males usually have additional genitourinary malformations [1].…”

“…All children presented the typical symptoms of SRNS and all had normal external genitalia at the time of nephrotic syndrome manifestation. In a previous study, all cases had also been screened for NPHS2 mutations which in the homozygous or compound heterozygous state are indicated to be among the most common underlying causes of familial and sporadic SRNS cases [28,30].…”

“…The WT1 gene exons 8 and 9 including flanking intronic sequences were subjected to PCR and direct sequencing using the following primers: exon 8 forward, 5´cctttaatgagatccccttttcc3´, exon 8 reverse, 5´ggggaaatgtggggtgtttcc3´, exon 9 forward, 5´cctcactgtgcc cacattgt3´, and exon 9 reverse, 5´gcactattccttctctcaactgag3( NCBI Reference Sequence: NG_009272.1), and standard protocols [30].…”

“…All cases had previously been investigated for the presence of mutations in the NPHS2 gene (encoding the kidneyexpressing protein podocin), which is considered to be the most common underlying genetic cause of childhood SRNS [5,30]. Four patients were identified with three different de novo heterozygous WT1 mutations (all previously described) and their clinical characteristics are presented.…”

The podocyte as a target: cyclosporin A in the management of the nephrotic syndrome caused by WT1 mutations

“…Only 5 of the 17 children with SRNS and NPHS2 mutations had a partial response to CsA administration [44]. Similarly, in another study, only a partial response was noticed in one of three patients with NPHS2 mutations and SRNS [34]. Unfortunately, clinical or genetic characteristics distinguishing the group of partial responders were not identified.…”