Nucleotide sequence of the 5′ noncoding region and part of the<i>gag</i>gene of mouse mammary tumor virus; identification of the 5′ splicing site for subgenomic mRNAs

Buetti, Elena; Firzlaff, J M; Pearson, Karen W.; Diggelmann, Heidi

doi:10.1093/nar/11.20.6943

Cited by 41 publications

(24 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In keeping with this notion, we observed that mouse mammary tumor virus Gag harbors an FPVV sequence which is very similar to the FPIV late-domain motif described recently for the matrix protein of Sendai virus (61). Mouse mammary tumor virus seems particularly noteworthy in this context since it contains a PTAP but no PPXY motif, like HIV Gag (11).…”

Section: Discussionsupporting

confidence: 86%

Nonstructural Protein 3 of Bluetongue Virus Assists Virus Release by Recruiting ESCRT-I Protein Tsg101

Wirblich

Bhattacharya

Roy

2006

J Virol

117

126

View full text Add to dashboard Cite

The release of Bluetongue virus (BTV) and other members of the Orbivirus genus from infected host cells occurs predominantly by cell lysis, and in some cases, by budding from the plasma membrane. Two nonstructural proteins, NS3 and NS3A, have been implicated in this process. Here we show that both proteins bind to human Tsg101 and its ortholog from Drosophila melanogaster with similar strengths in vitro. This interaction is mediated by a conserved PSAP motif in NS3 and appears to play a role in virus release. The depletion of Tsg101 with small interfering RNA inhibits the release of BTV and African horse sickness virus, a related orbivirus, from HeLa cells up to fivefold and threefold, respectively. Like most other viral proteins which recruit Tsg101, NS3 also harbors a PPXY late-domain motif that allows NS3 to bind NEDD4-like ubiquitin ligases in vitro. However, the late-domain motifs in NS3 do not function as effectively in facilitating the release of mini Gag virus-like particles from 293T cells as the late domains from human immunodeficiency virus type 1, human T-cell leukemia virus, and Ebola virus. A mutagenesis study showed that the arginine residue in the PPRY motif is responsible for the low activity of the NS3 late-domain motifs. Our data suggest that the BTV late-domain motifs either recruit an antagonist that interferes with budding or fail to recruit an agonist which is different from NEDD4.

show abstract

Section: Discussionsupporting

confidence: 86%

Nonstructural Protein 3 of Bluetongue Virus Assists Virus Release by Recruiting ESCRT-I Protein Tsg101

Wirblich

Bhattacharya

Roy

2006

J Virol

117

126

View full text Add to dashboard Cite

show abstract

“…3' oligo, GCGACCCCCATGAGTATATTTC (VJ83). A primer in the 5' noncoding region at the 5' splicing site for subgenomic mRNAs (31) was designed to specifically amplify spliced OILF mRNA: 5' oligo, CAGGGAACTGCAGTCTCGCCTA. The 3' oligo VJ83 described above was used to ascertain specificity for the MMTV(SW) ORF.…”

Section: Methodsmentioning

confidence: 99%

Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus.

Held

Shakhov

Izui

et al. 1993

The Journal of Experimental Medicine

132

125

View full text Add to dashboard Cite

SummarySuperantigens are defined by their ability to stimulate a large fraction of T cells via interaction with the T cell receptor (TCR) V/3 domain. Endogenous superantigens, classically termed minor lymphocyte-stimulating (Mls) antigens, were recently identified as products of open reading flames (ORF) in integrated proviral copies of mouse mammary tumor virus (MMTV). We have described an infectious MMTV homologue of the classical endogenous superantigen Mls-1 ~ (Mtv-7). The ORF molecules of both the endogenous Mtv-7 and the infectious MMTV(SW) interact with T cells expressing the TCR VB6, 7, 8.1, and 9 domains. Furthermore, the COOH termini of their ORF molecules, thought to confer TCR specificity, are very similar. Since successful transport of MMTV from the site of infection in the gut to the mammary gland depends on a functional immune system, we were interested in determining the early events after and requirements for MMTV infection. We show that MMTV(SW) infection induces a massive response of V~6 + CD4 + T cells, which interact with the viral ORE Concomitantly, we observed a B cell response and differentiation that depends on both the presence and stimulation of the superantigen-reactive T cells. Furthermore, we show that B cells are the main target of the initial MMTV infection as judged by the presence of the reverse-transcribed viral genome and ORF transcripts. Thus, we suggest that MMTV infection of B cells leads to ORF-mediated B-T cell interaction, which maintains and possibly amplifies viral infection. M inor lymphocyte-stimulating (Mls) antigens are encodedby an open reading frame (ORF) z in the 3' LTR of endogenous mouse mammary tumor virus (MMTV) (1-3). They stimulate a large proportion of T cells due to the fact that T cell reactivity to Mls antigens is determined by the usage of the V segment of the TCR B chain (4, 5). The classical (and strongest) Mls determinant, Mls-1 ', which interacts with T cells expressing VB6, 7, 8.1, and 9 elements (4-7), is encoded by the ORF of the Mtv-7 proviral locus (8). We have recently found an exogenous (infectious) MMTV, MMTV(SW), with properties of Mls-1 ' (9). The ORF molecules of Mtv-7 and MMTV(SW) display an almost identical amino acid sequence, particularly in COOH termini implied to confer TCR VB specificity. In fact, both endogenous Mtv-7 and infectious MMTV(SW) interact with the same TCR VB elements. In an MMTV-infected host, ORF-reactive T cells are deleted from both the thymic and peripheral T cell pool, although at a considerably slower rate than after expression of the endogenous Mtv-7 (Mls-l') locus. Furthermore, injection of adult mice with MMTV(SW) leads to expansion of V~6 + CD4 + T cells similar to that observed after injection of . A functional immune system seems to be a prerequisite for successful transport of MMTV to the mammary gland after neonatal infection through the gut mucosa. Thus, thymectomy, absence of T cells (in nude mice), or deletion of the ORF-reactive T cells prevent virus transmission to the next generation (lO-12).Whil...

show abstract

“…Unexpectedly, sequences similar to these motifs were detected in sequences complementary to the U5 regions of several mammalian retroviruses [SRV-1 (27), SRV-2 (28), MPMV (29), MMTV (30), HIV-1 (31), SIVcpz (32), EIAV (33), BIV127 (34), SA-OMVV (35)], and these sequences were located at distances from the respective primer-binding sites similar to the distance between the 3' end of the tRNA-related region and these two motifs in the SINEs (Fig. 4b).…”

mentioning

confidence: 99%

Several short interspersed repetitive elements (SINEs) in distant species may have originated from a common ancestral retrovirus: characterization of a squid SINE and a possible mechanism for generation of tRNA-derived retroposons.

Ohshima

Koishi²,

Matsuo³

et al. 1993

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Using labeled transcripts generated in vitro from squid total genomic DNA as a probe, we isolated and characterized a SINE that is present In the squid genome. The squid SINE appears to be derived from a tRNALYS. When the consensus sequences offive different SINEs with a tRNALY-like structure from distantly related species, including squid, were aligned, we found in the tRNA-unrelated region two sequence motifs that were almost identical among these five SINEs. This observation suggests a common evolutionary origin for these SINEs and/or some function(s) for these motifs. Similar sequences were unexpectedly found to be present in sequences complementary to the US regions of several mammalian retroviruses whose primer is a tRNALys. On the basis of these findings, we present a model for the generation of SINEs. We propose that they are derived from a "strong-stop DNA" with a primer tRNALys that is an intermediate in the reverse tanmscription of certain retroviruses. Our model suggests that a certain group of SINEs may have been generated by horizontal transmission, although it is not clear whether information was transmitted via a similar retrovirus or via an RNA or DNA of a SINE.

show abstract

Nucleotide sequence of the 5′ noncoding region and part of thegaggene of mouse mammary tumor virus; identification of the 5′ splicing site for subgenomic mRNAs

Cited by 41 publications

References 38 publications

Nonstructural Protein 3 of Bluetongue Virus Assists Virus Release by Recruiting ESCRT-I Protein Tsg101

Nonstructural Protein 3 of Bluetongue Virus Assists Virus Release by Recruiting ESCRT-I Protein Tsg101

Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus.

Several short interspersed repetitive elements (SINEs) in distant species may have originated from a common ancestral retrovirus: characterization of a squid SINE and a possible mechanism for generation of tRNA-derived retroposons.

Contact Info

Product

Resources

About