Nucleotide sequence of the 3' end of MCF 247 murine leukemia virus

Kelly, Mary Margaret; Holland, Christie A.; Lung, ML; Chattopadhyay, Sisir K.; Lowy, Douglas R.; Hopkins, Nancy

doi:10.1128/jvi.45.1.291-298.1983

Cited by 75 publications

(84 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In some cases, the structures of the recombinants were confirmed by analyzing RNase T1 fingerprints of viruses produced after transfection of the recombinants. The fingerprints were analyzed for the presence or absence of the unique MCF 247 or MCF 30-2 RNase Tl-resistant oligonucleotides in the precursor to the piSE gene (PrplSE gene) (29,34).…”

mentioning

confidence: 99%

“…Another molecular clone of MCF 247 (p247lb) did not produce infectious virus when transfected. The LTR of p247-lb was biologically functional when used to generate an infectious recombinant and has been sequenced (29).…”

mentioning

confidence: 99%

“…Two separate experiments suggest that the original MCF 30-2 virus contained a single copy of the duplicated enhancer sequence of MCF 247. First, the restriction mapping data showed that each of the three clones of MCF 30-2 had a (29,42). Oligonucleotides that have not been localized by either method are indicated in parenthesis (i.e., 30-2B and 107).…”

mentioning

confidence: 99%

“…**SSS*S*S*SSS5S*******55 S*******6**5*55*5* * MCF30-2 ************************************G************************************************** M CF247W nTCAAGTTcCCCAAAAGACCGGGAAAAAcCCCAAGCCTTATTTAAACTAACCAATCAGCTCGCTTCTCGCTTCTGTAACCGCGCTTTATG MCF2471b *********** ********** ****** MCF30-2 **********************A*********** ********************SS***S******************* 55* ***** MCF30-2 * ******** ***** ************************************ U5 MCF247VV AAAGCCTTTTGCTGTTGCAifCCGAATCGTGGTCTCGCTGATCCTTGGGAGGGTCTCCTCAGAGTGATTGACTGCCCAGCCTGGGGGTCTT MCF2471b **************************************ses******************************************* MCF30-2 ****************A**********************************************************************Nucleotide sequences of the pl5E genes and the LTRs of MCF 247 and MCF 30-2. (A) The nucleotide and predicted amino acid sequences of the pl5E envelope gene of MCF 30-2 were determined and compared with those of MCF 247(29). (B) The LTR sequences of separate clones of MCF 247 (p247-W) and MCF 30-2 were determined and compared with those published previously(29) for a clone of MCF 247 (p247-1b).…”

mentioning

confidence: 99%

“…(A) The nucleotide and predicted amino acid sequences of the pl5E envelope gene of MCF 30-2 were determined and compared with those of MCF 247(29). (B) The LTR sequences of separate clones of MCF 247 (p247-W) and MCF 30-2 were determined and compared with those published previously(29) for a clone of MCF 247 (p247-1b). *, Nucleotide sequences or amino acids identical to those shown on the top line.…”

mentioning

confidence: 99%

See 4 more Smart Citations

Influence of enhancer sequences on thymotropism and leukemogenicity of mink cell focus-forming viruses

Holland

Thomas

Chattopadhyay

et al. 1989

J Virol

Self Cite

View full text Add to dashboard Cite

Oncogenic mink cell focus-forming (MCF) viruses, such as MCF 247, show a positive correlation between the ability to replicate efficiently in the thymus and a leukemogenic phenotype. Other MCF viruses, such as MCF 30-2, replicate to high titers in thymocytes and do not accelerate the onset of leukemia. We used these two MCF viruses with different biological phenotypes to distinguish the effect of specific viral genes and genetic determinants on thymotropism and leukemogenicity. Our goal was to identify the viral sequences that distinguish thymotropic, nonleukemogenic viruses such as MCF 30-2 from thymotropic, leukemogenic viruses such as MCF 247. We cloned MCF 30-2, compared the genetic hallmarks of MCF 30-2 with those of MCF 247, constructed a series of recombinants, and tested the ability of the recombinant viruses to replicate in the thymus and to induce leukemia. The results established that (i) MCF 30-2 and MCF 247 differ in the numbers of copies of the enhancer sequences in the long terminal repeats. (ii) The thymotropic phenotype of both viruses is independent of the number of copies of the enhancer sequences. (iii) The oncogenic phenotype of MCF 247 is correlated with the presence in the virus of duplicated enhancer sequences or with the presence of an enhancer with a specific sequence. These results show that the pathogenic phenotypes of MCF viruses are dissociable from the thymotropic phenotype and depend, at least in part, upon the enhancer sequences. On the basis of these results, we suggest that the molecular mechanisms by which the enhancer sequences determine thymotropism are different from those that determine oncogenicity.

show abstract

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Influence of enhancer sequences on thymotropism and leukemogenicity of mink cell focus-forming viruses

Holland

Thomas

Chattopadhyay

et al. 1989

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

Rearrangement of c‐myc, pim‐1 and Mlvi‐1 and trisomy of chromosome 15 in MCF‐ and moloney‐MuLV‐induced murine T‐cell leukemias

Wirschubsky¹,

Tsichlis²,

Klein³

et al. 1986

Intl Journal of Cancer

View full text Add to dashboard Cite

Provirus insertion near the c-myc, pim-1 or Mlvi-1 genes occurred in 7 out of 59 virally induced T-cell leukemias. C-myc was exclusively rearranged in approximately 10% of MCF247-induced tumors while Mlvi-1 was rearranged to a similar frequency in Moloney-virus-induced lymphomas. Out of 25 karyotyped tumors, 9 (36%) showed trisomy of chromosome 15. Provirus insertion near c-myc, pim-1 or Mlvi-1 occurred both in diploid lymphomas and in tumors with trisomy 15. These results suggest that the molecular and cytogenetic changes observed in murine T-cell leukemias are independent tumor-associated events and that trisomy of chromosome 15 is a common tumor-progression-related event.

show abstract

The Role of Proximal and Distal Sequence Variations in the Presentation of an Immunodominant CTL Epitope Encoded by the Ecotropic AK7 MuLV

Kim¹,

Green²

1997

Virology

View full text Add to dashboard Cite

An emv-14-derived, replication-competent ecotropic murine leukemia virus [MuLV], designated AK7, was previously cloned from the AKXL-5 recombinant inbred mouse strain and partially characterized. While genetically encoding for an envelope-derived immunodominant CTL epitope [KSPWFTTL] located in the transmembrane region of p15TM, this virus, unlike the emv-11-derived virus AKR623, fails to be efficiently recognized by AKR/Gross MuLV-specific cytotoxic T lymphocytes [CTL]. AK7 thus provides the opportunity to study the role of retroviral sequence variations that are located outside of the immunodominant epitope as a mechanism of escape from CTL-mediated immune surveillance. In an attempt to identify which region[s] of the AK7 genome could account for its ability to evade efficient recognition by AKR/Gross MuLV-specific CTL, we have constructed recombinant murine retroviruses. The direct influence of a sequence variation twelve amino acids N-terminal to KSPWFTTL was explored with the use of chimeric viruses and determined not to significantly impair the presentation of KSPWFTTL to AKR/Gross MuLV-specific CTL. The long terminal repeat [LTR] derived from the AK7 virus, which possesses only one copy of the 99-base pair transcriptional enhancer in the U3 region, in contrast to AKR623 that possesses two copies of the tandem direct repeat enhancers, was also analyzed for its influence on the presentation of KSPWFTTL. Interestingly, our data indicate that the enhancer region derived from AK7 negatively influences the presentation of KSPWFTTL in the context of a recombinant AKR623 virus.

show abstract

Nucleotide sequence of the 3' end of MCF 247 murine leukemia virus

Cited by 75 publications

References 38 publications

Influence of enhancer sequences on thymotropism and leukemogenicity of mink cell focus-forming viruses

Influence of enhancer sequences on thymotropism and leukemogenicity of mink cell focus-forming viruses

Rearrangement of c‐myc, pim‐1 and Mlvi‐1 and trisomy of chromosome 15 in MCF‐ and moloney‐MuLV‐induced murine T‐cell leukemias

The Role of Proximal and Distal Sequence Variations in the Presentation of an Immunodominant CTL Epitope Encoded by the Ecotropic AK7 MuLV

Contact Info

Product

Resources

About