Nucleotide sequence of cattle FcGRIII: its identification in γfettδ T cells

Collins, Robert A.; Gelder, K.I.; Howard, Chris

doi:10.1007/s002510050228

Cited by 17 publications

(7 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Analysis at 25 cycles showed that the two NK cell subsets expressed the NK receptor genes NKp46 (CD335), KIR, FcγRIIIA (CD16), KLRD1 (CD94) (Fig. 3A ) [ 29 , 30 ]. No difference between the subsets measured as intensity of bands in agarose gel was detected.…”

Section: Resultsmentioning

confidence: 99%

“…The amount of cDNA template was measured using NanoDrop spectrophotometer (NanoDrop, Wilmington, DE, USA). Intron spanning primers generating products of about 500 bp were designed based on sequences previously described [ 29 , 30 ]. NKp46 forward: 5' GAGCGATGCCTTCCACACTTGC 3' and reverse 5' GGTTGTTGTAGGAGCCAAAGCATCTGT 3'; annealing temperature 68°C, CD16: forward 5' GTGGTGGCACAATGGGAC 3' and reverse 5' GCCATCCCTCCATTCCTC 3', annealing temp.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Bovine CD2-/NKp46+ cells are fully functional natural killer cells with a high activation status

et al. 2006

View full text Add to dashboard Cite

Background: Natural killer (NK) cells in the cow have been elusive due to the lack of specific NK cell markers, and various criteria including a CD3 -/CD2 + phenotype have been used to identify such cells. The recent characterization of the NK-specific NKp46 receptor has allowed a more precise definition of bovine NK cells. NK cells are known as a heterogeneous cell group, and we here report the first functional study of bovine NK cell subsets, based on the expression of CD2.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Bovine CD2-/NKp46+ cells are fully functional natural killer cells with a high activation status

et al. 2006

View full text Add to dashboard Cite

show abstract

“…Activating and inhibitory receptors are co-expressed by the majority of immune effector cells, and their relative expression determines the threshold of cell activation. Although these genes have been cloned and characterized in cows (Symons and Clarkson, 1992;Collins et al, 1997), no information is available about FcγR expression in the intestine of calves.…”

Section: Introductionmentioning

confidence: 99%

Changes in expression of antimicrobial peptides and Fc receptors in the small intestines of neonatal calves during the passive immunity period

Zhu

Zhao

Wang

et al. 2020

Journal of Dairy Science

View full text Add to dashboard Cite

The contribution of colostrum to passive immunity transfer and intestinal protection is well known; however, the effects of colostrum intake on the expression of antimicrobial peptides (AP) and Fc receptors in the intestine of neonatal calves are unclear. Our aim was to investigate changes in the expression of AP and Fc receptor in the small intestine of calves in the first 36 h postpartum. Twenty-four Holstein bull calves were used in this study, of which 18 calves were administered 3.2 L of pooled colostrum for each calf per meal via an esophageal tube. Calves were slaughtered at 8 h (1 meal at 1-2 h), 24 h (2 meals at 1-2 h and 10-12 h), and 36 h (3 meals at 1-2 h, 10-12 h, and 22-24 h) postpartum. The remaining 6 calves without any milk administration were slaughtered at 2 h postpartum. Samples of blood and jejunum digesta were collected to determine immunoglobulin concentration using ELISA. Samples of the duodenum, jejunum, and ileum tissues after slaughter were collected to determine AP and Fc receptor expression using quantitative real-time PCR. In calves administered colostrum, IgG concentration in jejunum digesta rapidly decreased in an age-dependent manner (33.41, 9.47, and 0.34 mg/mL at 8, 24, and 36 h, respectively), whereas serum IgG concentration increased significantly, from 0.25 μg/mL at 2 h to 21.72 mg/mL at 24 h. Cathelicidin-4, β-defensin (DEFB)-7, and enteric β-defensin expression was upregulated at 8 h postpartum in the duodenum and jejunum compared with that at 2 h, but progressive recovery was detected from 24 h onward. Higher expression of cathelicidin-4, regenerating family member 3γ, lysozyme (LYZ), LYZ1, and LYZ2 and lower expression of DEFB, DEFB1, DEFB7, DEFB10, and enteric β-defensin were observed in the duodenum and jejunum compared with the ileum. Differences in AP expression between intestinal regions suggested that the innate immune defense mechanism varied significantly among the duodenum, jejunum, and ileum. No difference in the expression of Fc fragment of the IgG receptor was observed either among ages or small intestinal regions. The Fcγ receptor (FcγR)Ia and FcγRIIb expression was the highest at 8 h compared with that at 2, 24, and 36 h, and expression of FcγRIa, FcγRIIb, and FcγRIIIa was higher in the duodenum and jejunum than in the ileum. These results indicated that AP and Fcγ receptors might play important roles in intestinal defense during the passive immunity period.

show abstract

“…The transmembrane form is expressed on NK cells, monocytes, macrophages, mast cells, and small T-cell subsets, while the GPI-linked form is expressed exclusively on neutrophils (Ravetch and Kinet, 1991). In non-primate species that demonstrate CD16 expression, no glypiated forms have been identified, and all CD16 + cell populations are thought to express the transmembrane form (Collins et al, 1997; Halloran et al, 1994; Hughes, 1996; Nishimura et al, 2000). …”

Section: Introductionmentioning

confidence: 99%

Generation and characterization of monoclonal antibodies to equine CD16

Noronha

Harman

Wagner

et al. 2012

Veterinary Immunology and Immunopathology

View full text Add to dashboard Cite

The low-affinity Fc receptor CD16 plays a central role in the inflammatory and innate immune responses of many species, but has not yet been investigated in the horse. Using the predicted extracellular region of equine CD16 expressed as a recombinant fusion protein with equine IL-4 (rIL-4/CD16), we generated a panel of mouse monoclonal antibodies (mAbs) that recognize equine CD16. Nine mAbs were chosen for characterization based upon recognition of CD16, but not IL-4, in ELISA. All nine mAbs recognized full-length, cell-surface CD16 expressed as a GFP fusion protein by CHO cells, but not the closely related Fc receptor CD32 expressed in the same system. In flow cytometric analysis with equine peripheral leukocytes, the mAbs labeled cells in the granulocyte, monocyte, and lymphocyte populations in a pattern consistent with other species. Monocytes that were strongly labeled with CD16 mAb 9G5 were also positive for the LPS receptor CD14. Cytospins made with peripheral leukocytes were immunohistochemically labeled and showed mAb recognition of primarily mononuclear cells. ELISA revealed that the nine mAbs can be grouped into three patterns of epitope recognition. These new antibodies will serve as useful tools in the investigation of equine immune responses and inflammatory processes.

show abstract

Nucleotide sequence of cattle FcGRIII: its identification in γfettδ T cells

Cited by 17 publications

References 0 publications

Bovine CD2-/NKp46+ cells are fully functional natural killer cells with a high activation status

Bovine CD2-/NKp46+ cells are fully functional natural killer cells with a high activation status

Changes in expression of antimicrobial peptides and Fc receptors in the small intestines of neonatal calves during the passive immunity period

Generation and characterization of monoclonal antibodies to equine CD16

Contact Info

Product

Resources

About