Nucleic Acid Polymers with Accelerated Plasma and Tissue Clearance for Chronic Hepatitis B Therapy

Abstract

REP 2139 is a nucleic acid polymer (NAP) currently under clinical development for chronic hepatitis B (HBV) therapy. This preclinical study investigated different REP 2139 analogs that would display reduced accumulation in the serum and tissues, while retaining an antiviral effect against HBV infection. REP 2139 analogs were evaluated in human plasma, CD-1 mice, cynomolgus monkeys, and Pekin ducks. Discrete ribose transformation to 2′OH in selected riboadenosines resulted in a slow degradation in acidified human plasma that plateaued after 48 hr. REP 2165, a REP 2139 analog containing three unmodified riboadenosines equally spaced throughout the polymer, showed similar plasma clearance and tissue distribution as REP 2139 in mice and cynomolgus monkeys after a single dose. Interestingly, after repeated administration, accumulation of REP 2165 in plasma and organs was reduced, indicating a dramatically faster rate of clearance from organs after therapy was ended in both species. Both REP 2139 and REP 2165 were well tolerated at clinically relevant doses, with no alterations in liver, kidney, or hematological function. In chronic duck HBV (DHBV) infection, REP 2165 displayed significantly reduced liver accumulation after repeated dosing but retained antiviral activity similar to REP 2139. These results indicate the therapeutic potential of REP 2165 against chronic HBV infection in patients is similar to REP 2139, but with significantly reduced drug accumulation and improved tissue clearance.

Nucleic acid polymer REP 2139 and nucleos(T)ide analogues act synergistically against chronic hepadnaviral infection in vivo in Pekin ducks

“…The loss of 4 of 10 animals in the REP 2139 group during the experiment, and the reduction of serum DHBsAg with TDF monotherapy, makes the statistical evaluation of DHBsAg reduction between groups and in the presence of REP 2139 difficult. Nonetheless, the elimination of detectable DHBsAg in all groups exposed to REP 2139 is consistent with the ability of NAPs to block the assembly/release of SVPs and to achieve clearance of serum DHBsAg as observed in previous studies, Importantly, persistence of functional control of DHBV infection during the follow‐up was only achieved in the presence of REP 2139. These effects have been shown to occur in the absence of any direct effect of NAPs on the immune response and to be the consequences of DHBsAg elimination.…”

“…Viremia was assessed by detection of DHBV DNA in duck serum using qPCR as described . Briefly, DNA extraction was performed on 100 μL of duck serum using the High Pure Viral Nucleic Acids kit (Roche Diagnostics, Meylan, France).…”

“…For intrahepatic DHBV DNA analysis, total DNA extraction was performed on deep‐frozen liver samples using the NucleoSpin Tissue kit (Macherey‐Nagel, Hoerdt, France). DHBV DNA was amplified in the LightCycler 480 (Roche Diagnostics, Bâle, Switzerland) instrument as described . In brief, 1× SYBR Green I Master mix (Roche Diagnostics, France) containing 20 pmol of each primer, 5′CTGACGGACAACGGGTCTAC‐3′ (position 1596‐1615) for the forward primer and 5′‐GGGTGGCAGAGGAGGAAGT‐3′ (position 1728‐1746) for the reverse primer, was used for DHBV DNA amplification.…”

“…For detection of viral cccDNA, digestion of relaxed circular DNA by Plasmid Safe ATP‐dependant DNase (Epicentre, Madison, WI) was first performed as described . cccDNA was then amplified using specific primers and established conditions . The number of vge per cell was calculated as described …”

“…However, this model also has limitations, given that monitoring of host immune responses remains difficult in the absence of commercial tools allowing the analysis of duck innate, humoral, and cellular immune responses, and there is no development of fibrosis or liver inflammation in this model. Interestingly, the antiviral activity of NAP monotherapy observed in the chronic DHBV model closely emulates the effects of NAPs in HBV infection in clinical trials, validating the preclinical performance of NAP‐based therapy in DHBV‐infected ducks as a reliable predictor of the effects of NAPs in HBV‐infected patients.…”