Nuclear translocation and transcription regulation by the membrane-associated guanylate kinase CASK/LIN-2

Hsueh, Yi‐Ping; Wang, Ting-Fang; Yang, Fu-Chia; Sheng, Morgan

doi:10.1038/35005118

Cited by 333 publications

(326 citation statements)

References 21 publications

Supporting

Mentioning

309

Contrasting

Unclassified

Order By: Relevance

“…Both proteins could be coimmunoprecipitated from rat brain extracts (48). Although the T-box transcription factor tbr-1 promotes CASK translocation to the nucleus to regulate reelin expression, syndecan has been shown to bind CASK to the plasma membrane and prevent nuclear translocation even in the presence of tbr-1 (42). However, a regulatory mechanism for the differential subcellular targeting of CASK is not known (49).…”

Section: Fig 4 Luciferase Assay To Quantify Sicd Generation In Hek2mentioning

confidence: 99%

“…Two L27 domains, a PDZ, a SH3, and a Hook domain form the middle part of the molecule. The PDZ domain of CASK is required for syndecan binding, whereas the guanylate kinase domain is required for binding to tbr-1 (42,43). The mechanism by which the subcellular distribution of CASK is regulated remains unknown.…”

Section: Syndecan-processing and Subcellular Distribution Of Cask-mentioning

confidence: 99%

“…The cytosolic multidomain protein CASK is alternatively targeted to the plasma membrane via binding to the C terminus of syndecan or to the nucleus via binding to the transcription factor tbr-1 (42). CASK contains an N-terminal calcium/calmodulin-dependent kinase-like domain and a C-terminal guanylate kinase domain, both of which appear to be enzymatically inactive.…”

Section: Syndecan-processing and Subcellular Distribution Of Cask-mentioning

confidence: 99%

See 2 more Smart Citations

Syndecan 3 Intramembrane Proteolysis Is Presenilin/γ-Secretase-dependent and Modulates Cytosolic Signaling

Schulz

Annaert

Vandekerckhove

et al. 2003

Journal of Biological Chemistry

View full text Add to dashboard Cite

The syndecans play critical roles in several signal transduction pathways. The core proteins of these heparan sulfate proteoglycans are characterized by highly conserved transmembrane and intracellular domains which are required for signaling across the membrane and for interaction with cytosolic proteins. However, regulatory mechanisms controlling these functions remain largely unknown. Here we show that, upon ligandinduced primary proteolytic cleavage within the ectodomain, the intracellular domain of syndecan 3 is released by regulated intramembrane proteolysis. The cleavage is mediated by presenilin/␥-secretase complex and negatively regulates the plasma membrane targeting of the transcriptional cofactor CASK.Heparan sulfate proteoglycans (HSPG) 1 are present on the surface of all adherent cells. Binding to a large number of ligands depends upon highly charged heparan sulfate chains, linear polysaccharide chains that can be modified by sequential enzymatic modifications. These modifications lead to enormous structural diversity (for review see Ref. 1). Although numerous functions for the heparan sulfate moiety of proteoglycans have been shown in vivo and in vitro, the roles of the core proteins remain largely elusive (2, 3). The syndecan family of HSPG, as opposed to the GPI-anchored glypicans or matrix-associated HSPG, contains a transmembrane and cytosolic domain that is highly conserved across homologues and species, suggesting an important role for this part of the protein (4). Indeed, a role in FGF signaling, neurite outgrowth, dendritic spine morphogenesis, and left-right axis formation has been demonstrated (5-8), but the regulatory mechanisms are incompletely understood. The cytosolic domain can be subdivided into a membrane-proximal C1 and a C-terminal C2 conserved region that is nearly identical in all syndecans and has a more variable V region in the middle. The most conserved residues are serines and tyrosines that at least partially undergo phosphorylation, a basic motif that binds nonreceptor tyrosine kinases and cytoskeletal proteins, and the C terminus that is required for interaction with PDZ proteins such as syntenin, CASK, synectin, or synbindin (for review see Ref. 4).The heparan sulfate-bearing syndecan ectodomain has been shown to undergo ligand-activated or stress-induced proteolytic cleavage and shedding (9 -11), but the fate of the Cterminal fragment (CTF) that remains associated with the membrane is unknown. We surmised that the remaining CTF is subject to further proteolytic degradation, ectodomain-shedding being a first step in an intracellular signaling cascade. Because regulated intramembrane proteolysis, a novel mechanism of signal transduction across the membrane (12), has been demonstrated to depend upon prior ectodomain cleavage of type I transmembrane protein substrates (13)(14)(15)(16)(17)(18)(19)(20)(21)(22) and is mediated by presenilins (PS) as part of a larger so-called ␥-secretase complex (23), we investigated whether syndecan 3 undergoes PS-dependent cleavage. EXPERI...

show abstract

Section: Fig 4 Luciferase Assay To Quantify Sicd Generation In Hek2mentioning

confidence: 99%

Section: Syndecan-processing and Subcellular Distribution Of Cask-mentioning

confidence: 99%

Section: Syndecan-processing and Subcellular Distribution Of Cask-mentioning

confidence: 99%

See 1 more Smart Citation

Syndecan 3 Intramembrane Proteolysis Is Presenilin/γ-Secretase-dependent and Modulates Cytosolic Signaling

Schulz

Annaert

Vandekerckhove

et al. 2003

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Despite its role as an organizer of protein complex assembly, it has been shown that CASK interacts via its guanylate kinase-like domain with the T-box transcription factor Tbr-1 (25). In conjunction with Tbr-1 it enters the nucleus and binds to the palindromic T-element (AATTTCACACCTAGGTGTGAAATT), thereby acting as a co-activator of transcription of T-elementcontaining promoters, e.g.…”

mentioning

confidence: 99%

Interaction of the Plasma Membrane Ca2+ Pump 4b/CI with the Ca2+/Calmodulin-dependent Membrane-associated Kinase CASK

Schuh

Uldrijan

Gambaryan

et al. 2003

Journal of Biological Chemistry

103

View full text Add to dashboard Cite

Spatial and temporal regulation of intracellular Ca 2؉ is a key event in many signaling pathways. Plasma membrane Ca 2؉ -ATPases (PMCAs) are major regulators of Ca 2؉ homeostasis and bind to PDZ (PSD-95/Dlg/ZO-1) domains via their C termini. Various membrane-associated guanylate kinase family members have been identified as interaction partners of PMCAs. In particular, SAP90/PSD95, PSD93/chapsyn-110, SAP97, and SAP102 all bind to the C-terminal tails of PMCA "b" splice variants. Additionally, it has been demonstrated that PMCA4b interacts with neuronal nitric-oxide synthase and that isoform 2b interacts with Na ؉ /H ؉ exchanger regulatory factor 2, both via a PDZ domain. CASK (calcium/calmodulin-dependent serine protein kinase) contains a calmodulin-dependent protein kinase-like domain followed by PDZ, SH3, and guanylate kinase-like domains. In adult brain CASK is located at neuronal synapses and interacts with various proteins, e.g. neurexin and Veli/LIN-7. In kidney it is localized to renal epithelia. Surprisingly, interaction with the Tbr-1 transcription factor, nuclear transport, binding to DNA Telements (in a complex with Tbr-1), and transcriptional competence has been shown. Here we show that the C terminus of PMCA4b binds to CASK and that both proteins co-precipitate from brain and kidney tissue lysates. Immunofluorescence staining revealed co-expression of PMCA, CASK, and calbindin-D-28K in distal tubuli of rat kidney sections. To test if physical interaction of both proteins results in functional consequences we constructed a T-element-dependent reporter vector and investigated luciferase activity in HEK293 lysates, previously co-transfected with PMCA4b expression and control vectors. Expression of wild-type PMCA resulted in an 80% decrease in T-element-dependent transcriptional activity, whereas co-expression of a point-mutated PMCA, with nearly eliminated Ca 2؉ pumping activity, had only a small influence on regulation of transcriptional activity. These results provide evidence of a new direct Ca 2؉ -dependent link from the plasma membrane to the nucleus. (12). In contrast to these observations, overexpression of PMCA4b in the myocardium of transgenic rats did not result in an altered regulation of contraction/relaxation cycle but in an enhanced growth response of cardiac myocytes to different stimuli (13). Additionally, it has been shown that the C termini of several PMCA variants, especially variants PMCA4b and PMCA2b, bind to PDZ domains of proteins of the MAGUK (membrane-associated guanylate kinases) family (14,15), to the PDZ domain of nitricoxide synthase I (nNOS, NOS-I (16)) and to Na ϩ /H ϩ exchanger regulatory factor (NHERF (23)). We observed that isoform PMCA4b (PMCA4CI) not only interacted physically with nitricoxide synthase I, but also down-regulated its activity in a dose-dependent manner through local Ca 2ϩ depletion (16). A compilation of interaction partners currently known is given in Table IA. Gene knock-out studies of PMCA2 have revealed balance and hearing deficits and slower gro...

show abstract

“…It is currently unknown how mLin-7C localizes at the nectin-based cell ± cell junctions, but the present results indicate that mLin-7C is associated with afadin or ZO-1 indirectly through an unknown molecule in an actin cytoskeleton-independent manner. mLin-7C forms a ternary complex with mLin-2 and mLin-10 (Borg et al, 1998;Butz et al, 1998) and each of these molecules interacts with many other molecules: mLin-7 with PSD-95, type 2 NMDA receptors, BGT-1, Pals, b-catenin, and VAM-1 (Jo et al, 1999;Perego et al, 1999Perego et al, , 2000Kamberov et al, 2000;Tseng et al, 2001); mLin-2 with neurexin, syndecan, protein 4.1, calcium channels, Tbr-1, hDlg, JAM, and rabphilin3A (Hata et al, 1996;Cohen et al, 1998;Hsueh et al, 1998Hsueh et al, , 2000Maximov et al, 1999;Nix et al, 2000;Martinez-Estrada et al, 2001;Zhang et al, 2001); and mLin-10 with amyloid precursor protein, Munc-18, neurexins, and KIF17 (Borg et al, 1996;Okamoto and SuÈ dhof, 1997;Biederer and SuÈ dhof, 2000;Setou et al, 2000). These earlier observations together with the present results suggest that these proteins directly or indirectly binding to mLin-7 are recruited to the nectinbased cell ± cell junctions.…”

Section: Discussionmentioning

confidence: 99%

Localization of mLin-7 at nectin-based cell–cell junctions

et al. 2002

View full text Add to dashboard Cite

In C. elegans, lin-7 as well as lin-2/lin-10 is involved in the proper localization of the LET-23 receptor tyrosine kinase that regulates vulval induction. The mammalian homologue, mLin-7, forms a ternary complex with the mammalian homologues of LIN-2 and LIN-10 and localizes at cell ± cell junctions in epithelial cells, but the mechanism of this localization of mLin-7 is unknown. Nectin is an immunoglobulin-like cell ± cell adhesion molecule that is involved in organization of adherens and tight junctions in epithelial cells. Nectin is indirectly associated with the cadherin ± catenin system and the actin cytoskeleton through afadin, an actin ®lament-binding protein. We showed here that mLin-7 localized at the nectin-based cell ± cell junctions. This localization of mLin-7 required the interaction of nectin with afadin, but not the cadherin ± catenin system or the actin cytoskeleton. mLin-7 did not directly interact with nectin or afadin. The results indicate that mLin-7 localizes at cell ± cell junctions through the nectin ± afadin system.

show abstract

Nuclear translocation and transcription regulation by the membrane-associated guanylate kinase CASK/LIN-2

Cited by 333 publications

References 21 publications

Syndecan 3 Intramembrane Proteolysis Is Presenilin/γ-Secretase-dependent and Modulates Cytosolic Signaling

Syndecan 3 Intramembrane Proteolysis Is Presenilin/γ-Secretase-dependent and Modulates Cytosolic Signaling

Interaction of the Plasma Membrane Ca2+ Pump 4b/CI with the Ca2+/Calmodulin-dependent Membrane-associated Kinase CASK

Localization of mLin-7 at nectin-based cell–cell junctions

Contact Info

Product

Resources

About