Novel subtractive transcription-based amplification of mRNA (STAR) method and its application in search of rare and differentially expressed genes in AD brains

Abstract

Background: Alzheimer's disease (AD) is a complex disorder that involves multiple biological processes. Many genes implicated in these processes may be present in low abundance in the human brain. DNA microarray analysis identifies changed genes that are expressed at high or moderate levels. Complementary to this approach, we described here a novel technology designed specifically to isolate rare and novel genes previously undetectable by other methods. We have used this method to identify differentially expressed genes in brains affected by AD. Our method, termed Subtractive Transcription-based Amplification of mRNA (STAR), is a combination of subtractive RNA/DNA hybridization and RNA amplification, which allows the removal of nondifferentially expressed transcripts and the linear amplification of the differentially expressed genes.

A novel brain-enriched E3 ubiquitin ligase RNF182 is up regulated in the brains of Alzheimer's patients and targets ATP6V0C for degradation

“…We have isolated a 300 bp cDNA fragment, 360nh, by subtractive hybridization using a pooled mRNA population from AD brains as a "tester" and the first strand cDNAs from a pooled age-matched control brains as a "driver" [ 10 ]. BLAST searches revealed that this fragment showed a significant sequence identity with human genomic clone RP11-127P7 on chromosome 6 (GenBank AL138718 ).…”

“…Since the RNF182 was found in the subtracted cDNA library containing genes potentially up regulated in AD brains, we re-examined these changes by qRT-PCR analysis (Fig. 4A ) of the RNA pools used to construct the original AD and control cDNA libraries [ 10 ]. These results were subsequently confirmed using 10 individual brain samples from a tissue bank (Table 1 ).…”

“…A 300 bp cDNA fragment, 360nh, was isolated by subtractive hybridization using the mRNA population from AD brains as a "tester" and the first strand cDNA from control brains as a "driver" [ 10 ]. To amplify the cDNA fragment overlapping with both 360nh and the existing mRNA (acc # AK090576), we used a forward RT-PCR primer 5'TGTTGTGGCCCTTAATCTGAGTGCTG 3' and a reverse primer 5' GATGTTGTTGTCATCGGGCAGGCTAC 3'.…”

“…This is a significant limitation as many transcripts expressed preferentially in the brain (e.g., neurotransmitter receptors and their regulatory factors) are present at very low levels [ 8 , 9 ]. Recently, we employed a subtractive hybridization and RNA amplification method to enrich and isolate rare and novel transcripts from AD brains [ 10 ]. Using this approach, we have isolated more than 200 genes, which are deferentially expressed, amongst these was a novel brain-enriched sequence that not only was up regulated in AD brains, but also in neuronal cells subjected to injuries.…”

A novel neuron-enriched protein SDIM1 is down regulated in Alzheimer's brains and attenuates cell death induced by DNAJB4 over-expression in neuro-progenitor cells

“…We have recently employed a subtractive hybridization and RNA amplification method to enrich and isolate rare and novel transcripts involved in LOAD. Using this approach, we have isolated a number of novel transcripts that are differentially expressed in the brains of AD patients [ 10 ]. Among these was a novel sequence, SDIM1, that not only was down regulated in AD brains, but was also very responsive to stress conditions mimicking the injurious insults that may cause neurodegeneration in AD brain.…”