Novel Repeat Elements Direct Rat Proenkephalin Transcription during Spermatogenesis

Liu, Feng; Tokeson, J. P. E.; Persengiev, Stephan P.; Ebert, Karl M.; Kilpatrick, Daniel L.

doi:10.1074/jbc.272.8.5056

Cited by 18 publications

(27 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Protein Extraction-Nuclei were isolated from cell cultures and tissues and extracted using protocols outlined in earlier studies (14). Whole-cell protein extraction was performed as previously described (15).…”

Section: Methodsmentioning

confidence: 99%

A Role for Nuclear Factor I in the Intrinsic Control of Cerebellar Granule Neuron Gene Expression

Wang

Stock

Gronostajski

et al. 2004

Journal of Biological Chemistry

Self Cite

107

View full text Add to dashboard Cite

Nervous system formation requires the elaboration of a complex series of differentiation events in both a spatially and maturation-regulated manner. A fundamental question is how neuronal subtype specification and developmental gene expression are controlled within maturing neurons. The ␣6 subunit of the ␥-aminobutyric acid type A (GABA A ) receptor (GABRA6) is preferentially expressed in cerebellar granule neurons and is part of an intrinsic program directing their differentiation. We have employed a lentiviral approach to examine the transcriptional mechanisms controlling neuronal subtype-selective expression of this gene. These studies demonstrated that nuclear factor I (NFI) proteins are required for both transgenic GABRA6 promoter activity as well as endogenous expression of this gene in cerebellar granule neurons. Chromatin immunoprecipitation also showed that NFI proteins are bound to the GABRA6 promoter in these cells in vivo. Furthermore, analyses of gene knockout mice revealed that Nfia is specifically required for normal expression of the GABRA6 gene in cerebellar granule neurons. NFI expression and DNA binding activity are highly enriched in granule neurons, implicating this transcription factor family in the neuronal subtype-selective expression of the GABRA6 gene. These studies define a new role for NFI proteins as neuronal subtype-enriched transcriptional regulators that participate in an intrinsic transcriptional program directing the differentiation of cerebellar granule neurons.Fundamental to nervous system development is the specification and maturation of diverse neuronal populations that ultimately assemble into a complex synaptic network. These events require the appropriate spatiotemporal expression of an array of different genes during development, and a critical question is the nature of the transcriptional program that controls their proper expression. Several neuron-enriched transcription factors have been directly implicated in the determination of different neuronal populations (1). However, much remains to be learned regarding the roles of individual trans-regulators and their interactions in directing the phenotypes of distinct neuronal subtypes at different phases of their maturation.Cerebellar granule neurons (CGNs) 1 elaborate a well defined terminal differentiation program (2) and provide an excellent model of both cell-specific and developmental regulation of neuronal differentiation. Postnatally, newly born granule neurons migrate from the premigratory zone to form the internal granule cell layer, whereupon dendrite formation and synaptic connections with excitatory mossy fibers and inhibitory Golgi type II neurons ensue. Type A ␣-aminobutyric acid receptors (GABA A R) are present in synaptic and extrasynaptic regions of CGNs associated with inhibitory inputs from Golgi type II cells. During CGN differentiation, GABA A Rs undergo a maturationdependent change from mainly benzodiazepine-sensitive to benzodiazepine-insensitive forms (3). This is associated with a switch in GABA ...

show abstract

Section: Methodsmentioning

confidence: 99%

A Role for Nuclear Factor I in the Intrinsic Control of Cerebellar Granule Neuron Gene Expression

Wang

Stock

Gronostajski

et al. 2004

Journal of Biological Chemistry

Self Cite

107

View full text Add to dashboard Cite

show abstract

“…A double-stranded GCP1-32 monomer containing the two repeats (CTCCAG) (27) and BamHI 5Ј overhangs was generated by annealing the complementary oligodeoxynucleotides (ODNs) GATC CGAACTCCAGTGTTCGCTCCAGAATCTTGCCC and GATCGGGCAA GATTCTGGAGCGAACACTGGAGTTCG (repeats are underlined). The monomer duplex was end labeled with [␥-32 P]ATP and then self-ligated to generate a concatenated probe consisting mainly of approximately six copies of GCP1-32.…”

Section: Cloning Of Gcp1-binding Proteinsmentioning

confidence: 99%

“…In order to explore transcriptional programs controlling spermatogenesis, we have previously examined the cell-and stage-specific regulation of the male germ line proenkephalin promoter in rodents (14,27). This promoter is expressed exclusively by spermatogenic cells and is highly up-regulated in pachytene spermatocytes and haploid round spermatids (55).…”

mentioning

confidence: 99%

Expression of a Novel, Sterol-Insensitive Form of Sterol Regulatory Element Binding Protein 2 (SREBP2) in Male Germ Cells Suggests Important Cell- and Stage-Specific Functions for SREBP Targets during Spermatogenesis

Wang

Liu

Millette

et al. 2002

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

Cholesterol biosynthesis in somatic cells is controlled at the transcriptional level by a homeostatic feedback pathway involving sterol regulatory element binding proteins (SREBPs). These basic helix-loop-helix (bHLH)-Zip proteins are synthesized as membrane-bound precursors, which are cleaved to form a soluble, transcriptionally active mature SREBP that regulates the promoters for genes involved in lipid synthesis. Homeostasis is conferred by sterol feedback inhibition of this maturation process. Previous work has demonstrated the expression of SREBP target genes in the male germ line, several of which are highly up-regulated during specific developmental stages. However, the role of SREBPs in the control of sterol regulatory elementcontaining promoters during spermatogenesis has been unclear. In particular, expression of several of these genes in male germ cells appears to be insensitive to sterols, contrary to SREBP-dependent gene regulation in somatic cells. Here, we have characterized a novel isoform of the transcription factor SREBP2, which is highly enriched in rat and mouse spermatogenic cells. This protein, SREBP2gc, is expressed in a stage-dependent fashion as a soluble, constitutively active transcription factor that is not subject to feedback control by sterols. These findings likely explain the apparent sterol-insensitive expression of lipid synthesis genes during spermatogenesis. Expression of a sterol-independent, constitutively active SREBP2gc in the male germ line may have arisen as a means to regulate SREBP target genes in specific developmental stages. This may reflect unique roles for cholesterol synthesis and other functional targets of SREBPs during spermatogenesis.

show abstract

“…5B). This expression frequency (67%) is typical for active transgene promoters (26,34). No activity was detected in somatic tissues from any transgenic mice (data not shown).…”

Section: Vol 24 2004mentioning

confidence: 96%

“…A 1.8-kb rat SREBP2gc cDNA was used as the probe for Northern analysis. Nuclear extracts were prepared from cell lines and enriched mouse spermatogenic cells by high salt extraction (26). Western blotting was performed as described previously (50) using antiserum raised against mouse SREBP2.…”

Section: Methodsmentioning

confidence: 99%

Novel Role for a Sterol Response Element Binding Protein in Directing Spermatogenic Cell-Specific Gene Expression

Wang¹,

Agustin

Witman

et al. 2004

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

Sperm are highly specialized cells, and their formation requires the synthesis of a large number of unique mRNAs. However, little is known about the transcriptional mechanisms that direct male germ cell differentiation. Sterol response element binding protein 2gc (SREBP2gc) is a spermatogenic cell-enriched isoform of the ubiquitous transcription factor SREBP2, which in somatic cells is required for homeostatic regulation of cholesterol. SREBP2gc is selectively enriched in spermatocytes and spermatids, and, due to its novel structure, its synthesis is not subject to cholesterol feedback control. This suggested that SREBP2gc has unique cell-and stage-specific functions during spermatogenesis. Here, we demonstrate that this factor activates the promoter for the spermatogenesis-related gene proacrosin in a cell-specific manner. Multiple SREBP2gc response elements were identified within the 5-flanking and proximal promoter regions of the proacrosin promoter. Mutating these elements greatly diminished in vivo expression of this promoter in spermatogenic cells of transgenic mice. These studies define a totally new function for an SREBP as a transactivator of male germ cell-specific gene expression. We propose that SREBP2gc is part of a cadre of spermatogenic cell-enriched isoforms of ubiquitously expressed transcriptional coregulators that were specifically adapted in concert to direct differentiation of the male germ cell lineage.Sperm are highly differentiated cells that are uniquely adapted to their function as motile cells mediating fertilization. As such, they serve as an important model for exploring regulatory programs responsible for cellular differentiation (17). Spermatogenesis consists of a complex interplay between cellspecific gene transcription, RNA processing, and translational regulation (8,17). It occurs in a series of proliferation and differentiation stages, which can be subdivided into mitotic, meiotic, and spermiogenic phases. Each phase is characterized by distinct cell types, namely, spermatogonia, spermatocytes, and spermatids, respectively. The highly specialized nature of sperm is reflected in the large number of cell-specific transcripts and proteins they express (8), many of which are associated with unique sperm structures such as the acrosome, sperm tail, and the highly compacted sperm chromosomal DNA. Unique proteins also are required to meet specialized requirements for energy metabolism, meiosis, and the maturation of haploid cells, including cell-specific proteins that compensate for X chromosome inactivation (e.g., phosphoglycerate kinase 2 [pgk-2]) (9). These various gene products also must be expressed at the appropriate time to ensure normal development. Thus, sperm formation requires both the generation of a large number of cell-specific gene products and the coordination of this differentiation program in a stepwise, stage-appropriate manner. A key question is the nature of the transcriptional network that controls the elaboration of this program.Cell-specific transcription from ...

show abstract

Novel Repeat Elements Direct Rat Proenkephalin Transcription during Spermatogenesis

Cited by 18 publications

References 48 publications

A Role for Nuclear Factor I in the Intrinsic Control of Cerebellar Granule Neuron Gene Expression

A Role for Nuclear Factor I in the Intrinsic Control of Cerebellar Granule Neuron Gene Expression

Expression of a Novel, Sterol-Insensitive Form of Sterol Regulatory Element Binding Protein 2 (SREBP2) in Male Germ Cells Suggests Important Cell- and Stage-Specific Functions for SREBP Targets during Spermatogenesis

Novel Role for a Sterol Response Element Binding Protein in Directing Spermatogenic Cell-Specific Gene Expression

Contact Info

Product

Resources

About