Novel PTP1B inhibitors identified by DNA display of fragment pairs

Barluenga, Sofía; Zambaldo, Claudio; Ioannidou, H. A.; Ciobanu, Mihai; Morieux, Pierre; Daguer, Jean‐Pierre; Winssinger, Nicolas

doi:10.1016/j.bmcl.2015.11.102

Cited by 36 publications

(30 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…28,29 Optimal fragment pairs can be used for the synthesis of focused libraries. 29,30 Using this technology, we focused our screen on binders targeting the regulatory domains of p97, the N-terminal domain and the D1 ATPase domain (ND1L, Figure 1B).…”

Section: Introductionmentioning

confidence: 99%

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

et al. 2019

Self Cite

View full text Add to dashboard Cite

VCP/p97 belongs to the AAA+ ATPase family and has an essential role in several cellular processes ranging from cell division to protein homeostasis. Compounds targeting p97 inhibit the main ATPase domain and cause cell death. Here, using PNA-encoded chemical libraries, we have identified two small molecules that target the regulatory domain of p97, comprising the N-terminal and the D1 ATPase domains, and do not cause cell death. One molecule, NW1028, inhibits the degradation of a p97-dependent reporter, whereas the other, NW1030, increases it. ATPase assays show that NW1028 and NW1030 do not affect the main catalytic domain of p97. Mapping of the binding site using a photo-affinity conjugate points to a cleft at the interface of the N-terminal and the D1 ATPase domains. We have therefore discovered two new compounds that bind to the regulatory domain of p97 and modulate specific p97 cellular functions. Using these compounds, we have revealed a role for p97 in the regulation of mitotic spindle orientation in HeLa cells.Chemicals used in this study are: MG132 and DBeQ (Sigma-Aldrich), NMS-873 (Xcessbio), chloroquine (Enzo lifescience), cycloheximide (Millipore), puromycin (Sigma-Aldrich), G418 (InvivoGen) and luciferin (AppliChem). Cell culture and transfections. The following cell lines were gifts from specified groups: HeLa cells expressing UbG76V-GFP and ODD-LUC, gift of T. Chou 16 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA); HEK 293T, RPE1, HeLa, HeLa H2B-mCherry/GFP-α-tubulin41 from P. Meraldi (University of Geneva, Switzerland); MEF cells expressing mCherry-GFP-LC3b, from P. Taylor (Tresse et al., 2010) (St. Jude Children's Research Hospital, USA).Cell lines were grown in Dulbecco's modified eagle medium (Gibco DMEM) supplemented with FCS 10%, penicillin 100units/ml and streptomycin 100mg/ml) at 37°C with 5% CO2 in a humified incubator. HEK 293T cells were supplemented with 1% Glutamine. HeLa cells expressing UbG76V-GFP and ODD-LUC were selected with 2.5µg/ml puromycin and 0.1mg/ml G418(Chou and Deshaies, 2011). Transient expression was performed using lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.Plasmids and oligonucleotides. The following constructs were used in this work for protein expression and site-directed mutagenesis: pQE9-His-p97deltaD2 was provided by Addgene (ID17229); pET15-His-p97 and pET24b-His-p97ND1L was provided by TF. Chou 34 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA).The mutant p97 E305Q were obtained by site-directed mutagenesis using the following oligonucleotides: p97 E305Q (forward: GCCATCATCTTCATTGAT CAGCTAGATGCCATCGCTCCC; reverse: GGGAGCGATGGCATCTAGCTGATCAATGAAGATGATGGC). The following oligonucleotides were used to verify the site-directed mutagenesis:ATGGCTTCTGGAGCCGATTC, TTACCCGATGTCTTCCCAGGTTAC, GTAACCTGGGAAGACATCGGG, GGAACAGGTAGCCAATGAGACTC and GGCCATCCGTGAATCCATCG.Recombinant protein expression and purification. All recombinant proteins (ND1L and p97 E305Q) were expressed in E.co...

show abstract

Section: Introductionmentioning

confidence: 99%

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…1). 36,[44][45][46][47][48][49][50] We reasoned that this method could allow us to discriminate between covalent and non-covalent ligands using a denaturing wash that would denature proteins and compromise noncovalent ligand-protein interactions. However, aside from peptide-based libraries targeting proteases, 33,[37][38] no DNA or PNA-encoded library specifically designed to engage diverse protein targets in covalent interactions had been reported.…”

Section: Resultsmentioning

confidence: 99%

Screening for covalent inhibitors using DNA-display of small molecule libraries functionalized with cysteine reactive moieties

et al. 2016

View full text Add to dashboard Cite

DNA-encoded chemical libraries are increasingly used to identify leads for drug discovery or chemical biology. Despite the resurging interest in covalent inhibitors, libraries are typically designed with synthon filtered out for reactive functionalities that can engage a target through covalent interactions. Herein, we report the synthesis of two libraries containing Michael acceptors to identify cysteine reactive ligands. We developed a simple procedure to discriminate between covalent and high affinity non-covalent inhibitors using DNA display of the library in a microarray format. The methodology was validated with known covalent and high affinity non-covalent kinase inhibitors. Screening of the library revealed novel covalent inhibitors for MEK2 and ERBB2

show abstract

“…DEL successes are not limited to the pharmaceutical industry, on-the-contrary, several academic labs have harnessed DEL to elucidate new binding molecules for various target proteins. [49][50][51][52][53] As an example, the group of Prof. Robert Lefkowitz at Duke University screened DNA encoded smallmolecule libraries containing 190 million compounds against purified human β2-adrenergic receptor (β2AR, Figure 4C). [54,55] This screening campaign afforded the discovery of a small molecule which exhibits a unique chemotype and low micromolar affinity for the target.…”

Section: Recent Successesmentioning

confidence: 99%

DNA Encoded Libraries: A Visitor's Guide

Flood

Kingston

Vantourout

et al. 2020

Israel Journal of Chemistry

View full text Add to dashboard Cite

In 1992, Brenner and Lerner hypothesized that individual chemical transformations could be encoded in DNA, allowing the rapid synthesis and screening of large collections of small molecules. Since their report, huge investments into the development of the DNA encoded library (DEL) technology have enabled the acceleration of the drug discovery process especially early phase discovery undertakings such as target validation and hit identification. As DEL lies at the nexus between chemistry and biology, there is an increasing need to expand the toolboxes of both organic transformations and biological methods. However, the myriad of techniques and reactions already reported can be difficult to digest for practitioners whose expertise resides outside the realm of DEL. This review therefore focuses on a stepwise presentation of DEL from the basic concepts to newest developments. The presentation includes the history, fundamentals, and successes of DEL, different methods for DEL synthesis and affinity selection, the conventional transformations, and finally the latest developments from a synthetic organic perspective.

show abstract

Novel PTP1B inhibitors identified by DNA display of fragment pairs

Cited by 36 publications

References 68 publications

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

Screening for covalent inhibitors using DNA-display of small molecule libraries functionalized with cysteine reactive moieties

DNA Encoded Libraries: A Visitor's Guide

Contact Info

Product

Resources

About