Novel NDUFA13 Mutations Associated with OXPHOS Deficiency and Leigh Syndrome: A Second Family Report

Abstract

Leigh syndrome (LS) usually presents as an early onset mitochondrial encephalopathy characterized by bilateral symmetric lesions in the basal ganglia and cerebral stem. More than 75 genes have been associated with this condition, including genes involved in the biogenesis of mitochondrial complex I (CI). In this study, we used a next-generation sequencing (NGS) panel to identify two novel biallelic variants in the NADH:ubiquinone oxidoreductase subunit A13 (NDUFA13) gene in a patient with isolated CI deficiency in skeletal muscle. Our patient, who represents the second family report with mutations in the CI NDUFA13 subunit, presented with LS lesions in brain magnetic resonance imaging, mild hypertrophic cardiomyopathy, and progressive spastic tetraparesis. This phenotype manifestation is different from that previously described in the first NDUFA13 family, which was predominantly characterized by neurosensorial symptoms. Both in silico pathogenicity predictions and oxidative phosphorylation (OXPHOS) functional findings in patient’s skin fibroblasts (delayed cell growth, isolated CI enzyme defect, decreased basal and maximal oxygen consumption and as well as ATP production, together with markedly diminished levels of the NDUFA13 protein, CI, and respirasomes) suggest that these novel variants in the NDUFA13 gene are the underlying cause of the CI defect, expanding the genetic heterogeneity of LS.

NDUFA13/YJEFN3 is differentially expressed in the brains of patients with schizophrenia.

“…Germline mutation of NDUFA13 has been found in two patients, sisters, with dyskinesia, sensory deficiencies and early onset hypotonia; muscle and fibroblasts from these patients possess reduced complex I activity, supporting NDUFA13 function in cellular respiration 8 . Another case report documents a patient with Leigh Syndrome lesions in the brain, with hypotonia, nystagmus and spastic tetraparesis; next-generation sequencing identified biallelic NDUFA13 mutations 9 . This patients fibroblasts were also deficient in complex I function as measured by basal oxygen consumption rate, maximum oxygen consumption rate and ATP production, indicating defects in oxidative phosphorylation 9 .…”

“…Another case report documents a patient with Leigh Syndrome lesions in the brain, with hypotonia, nystagmus and spastic tetraparesis; next-generation sequencing identified biallelic NDUFA13 mutations 9 . This patients fibroblasts were also deficient in complex I function as measured by basal oxygen consumption rate, maximum oxygen consumption rate and ATP production, indicating defects in oxidative phosphorylation 9 .…”

A novel TRMT5 mutation causes a complex inherited neuropathy syndrome: The role of nerve pathology in defining a demyelinating neuropathy

“…Multiple mtDNA deletions in DNA from patients' muscle biopsies were analysed by long‐range PCR amplification of the whole mtDNA molecule using the primers pair 5′‐CCGCACAAGAGTGCTACTCTCCTC‐3′ and 5′‐GATATTGATTTCACGGAGGATGGTG‐3′ and the SequalPrep™ Long PCR Kit (ThermoFisher Scientific, MA, USA) and 19 common point mtDNA mutations (m.3243A > G; m.3460G > A; m.8344A > G; m.8993 T > G/T > C; m.9176 T > C/T > G; m.10158 T > C; m.10191 T > C; m.13513G > A; m.13514A > G; m.11777C > A; m.11778G > A; m.11832G > A; m.14459G > A; m.14482C > A/C > G; m.14484 T > C; m.14487 T > C) were analysed in DNA from patients' skeletal muscle by minisequencing‐SNaPShot Multiplex (ThermoFisher, Applied Biosystems) 10 …”

An Overview of Mitochondrial Protein Defects in Neuromuscular Diseases

“…Their clinical phenotypes frequently include Leigh syndrome (LS) [ 80 , 81 ], fatal infantile lactic acidosis [ 82 ], leukodystrophy with macrocephaly [ 83 ], and neonatal cardiomyopathy with lactic acidosis (NCLA) [ 84 , 85 ]. The neuromuscular phenotypes associated with the mutations of proteins belonging to the subunits of Complex I and its assembly factors are summarized in Table 1 .…”