Novel mutations of PIK3CA gene in head and neck squamous cell carcinoma

Alamri, Ali; Vatte, Chittibabu; Cyrus, Cyril; Chathoth, Shahanas; Hashim, Tariq Mohammad; Mohamed, Y. A.; Ali, Rudaynah Al; Alsaid, Abir; Ali, Amein Al

doi:10.3233/cbm-160576

Cited by 9 publications

(7 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our study cohort is in line with this, as 66% of the patients were males and 58% of the male patient group were smokers compared with 18.75% in female patients. It is known that the higher-grade HNSCC tumors are associated with a higher number of mutations 17. This has also been confirmed by the present study, where a higher number of mutations were observed in high pathological grade tumors ( P =0.026).…”

Section: Discussionsupporting

confidence: 91%

“…Sparse data are available on EGFR-TK domain mutations in HNSCC globally and in the Saudi population. Previously, the PIK3CA mutation pattern in HNSCC patients of Saudi origin was studied, and a high frequency of PIK3CA mutations and five novel mutations were reported 17. The PI3K signaling molecules upon binding to the phosphorylated TK initiate a cascade of intracellular signal transduction pathways.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Tyrosine kinase domain mutations of <em>EGFR</em> gene in head and neck squamous cell carcinoma

Vatte

Amri

Cyrus

et al. 2017

OTT

Self Cite

View full text Add to dashboard Cite

BackgroundEpidermal growth factor receptor (EGFR) is a commonly altered gene that is identified in various cancers, including head and neck squamous cell carcinoma (HNSCC). Therefore, EGFR is a promising molecular marker targeted by monoclonal antibodies and small molecule inhibitors targeting the tyrosine kinase (TK) domain.ObjectiveThe objective of this study was to investigate the spectrum of mutations in exons 18, 19, 20, and 21 of the EGFR gene in HNSCC patients.Materials and methodsThis retrospective study included 47 confirmed HNSCC cases. Mutations in the TK domain, exons 18, 19, 20, and 21 of the EGFR gene, were detected by Scorpion® chemistry and ARMS® technologies on Rotor-Gene Q real-time polymerase chain reaction.ResultsThe tumors exhibited EGFR-TK domain mutations in 57% of cases. Four cases of T790M mutations were reported for the first time among HNSCC patients. Out of the total mutations, L861Q (exon 21), exon 20 insertions and deletions of exon 19 accounted for the majority of mutations (21%, 19%, and 17%, respectively). EGFR mutation status was correlated with the higher grade (P=0.026) and advanced stage (P=0.034) of HNSCC tumors.ConclusionHigher frequency of EGFR-TK domain mutations together with the presence of the T790M mutation suggests that identification of these mutations might streamline the therapy and provide a better prognosis in HNSCC cases.

show abstract

Section: Discussionsupporting

confidence: 91%

Section: Introductionmentioning

confidence: 99%

Tyrosine kinase domain mutations of <em>EGFR</em> gene in head and neck squamous cell carcinoma

Vatte

Amri

Cyrus

et al. 2017

OTT

Self Cite

View full text Add to dashboard Cite

show abstract

“…The thermocycling conditions were as follows: 1 cycle of 5 min at 95°C; 40 cycles of 30 sec at 95°C, 30 sec at 54°C, and 30 sec at 72°C; and 1 cycle of 5 min at 72°C. Subsequently, the PCR products were analyzed on a 2% agarose gel, which indicated the expected amplicon for exon 9 of 195 bp and for exon 20 of 338 bp (24). The sequence analysis was performed using the CodonCode aligner software (CodonCode Corporation, Centerville, MA, USA).…”

Section: Methodsmentioning

confidence: 99%

Helical and kinase domain mutations of PIK3CA, and their association with hormone receptor expression in breast cancer

et al. 2019

Self Cite

View full text Add to dashboard Cite

Breast cancer is one of the major causes of female morbidity and mortality, accounting for ~25% of the total cancer cases in women. Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic α subunit ( PIK3CA ) mutations serve a major role in downstream signaling of receptor tyrosine kinases. The present study aimed to elucidate the frequency of exon 9 and 20 mutations of PIK3CA and their role in disease progression. A total of 118 tumor samples from confirmed breast cancer patients were collected from the histopathology laboratory at King Fahd Hospital of the University (Al-Khobar, Saudi Arabia). Sanger sequencing was performed on extracted DNA to identify the mutations on exons 9 and 20 of PIK3CA . The results were further validated by competitive allele-specific TaqMan polymerase chain reaction. Three mutations, namely E542K and E545K within exon 9, and H1047R within exon 20, were observed in 25 patients (21.2%). Among these, 18 patients carried the H1047R mutation of the kinase domain, while the remaining 7 patients carried mutations in the helical domain. PIK3CA mutations were associated with the estrogen receptor-positive/progesterone receptor-positive (ER + /PR + ) group of tumors in contrast to the ER − /PR − group (P=0.021). Furthermore, it was observed that the PIK3CA mutation was associated with a poor disease prognosis. Taken together, the current study emphasized the potential of PIK3CA mutations as an important biomarker for breast cancer classification and the possible use of PIK3CA inhibitor as targeted therapy for breast cancer.

show abstract

“…Distribution of polymorphisms and novel mutations on exon 2 and exon 5 of UCP1 gene was carried out using capillary sequencing by ABI 3500 genetic analyzer (Thermo Scientific, CA, USA) as previously reported [ 23 ]. The targeted gene sequence was amplified using polymerase chain reaction with specific primers for Exon 2 (Fwd-5’TCTGCACCTTTCTTATTTC3’ Rev-5’TCTCGCCAATTTGTTATGAA3’) and Exon 5 (Fwd-5’CAAAAGTCTGATGTTGAC3’ Rev-5’GAAATCTGTGGCAAGGAAAAGT3’) on a thermal cycler S1000 (Bio Rad, Hercules, California, USA).…”

Section: Methodsmentioning

confidence: 99%

Association of Uncoupling Protein 1 (UCP1) gene polymorphism with obesity: a case-control study

et al. 2018

Self Cite

View full text Add to dashboard Cite

BackgroundObesity is one of the main causes of morbidity and mortality worldwide. More than 120 genes have been shown to be associated with obesity related phenotypes. The aim of this study was to determine the effect of selected genetic polymorphisms in Uncoupling protein 1 (UCP1) and Niemann-Pick C1 (NPC1) genes in an obese population in Saudi Arabia.MethodsThe genotypes of rs1800592, rs10011540 and rs3811791 (UCP1 gene) and rs1805081 and rs1805082 (NPC1 gene) were determined in a total of 492 subjects using TaqMan chemistry by Real-time PCR. In addition, capillary sequencing assay was performed to identify two specific polymorphisms viz., rs45539933 (exon 2) and rs2270565 (exon 5) of UCP1 gene.ResultsA significant association of UCP1 polymorphisms rs1800592 [OR, 1.52 (1.10–2.08); p = 0.009] was observed in the obese cohort after adjusting with age, sex and type 2 diabetes. Further BMI based stratification revealed that this association was inconsistent with both moderate and extreme obese cohort. A significant association of UCP1 polymorphisms rs3811791 was observed only in the moderate-obese cohort [OR = 2.89 (1.33–6.25); p = 0.007] but not in the extreme-obese cohort indicating an overlying genetic complexity between moderate-obesity and extreme-obesity. The risk allele frequencies, which were higher in moderate-obese cohort, had abnormal HDL, LDL and triglyceride levels.ConclusionThe rs1800592 and rs3811791 of UCP1 gene are associated with obesity in general and in the moderate-obese group in particular. The associated UCP1 polymorphisms in the moderate-obese group may regulate the impaired energy metabolism which plays a significant role in the initial stages of obesity.Electronic supplementary materialThe online version of this article (10.1186/s12881-018-0715-5) contains supplementary material, which is available to authorized users.

show abstract

Novel mutations of PIK3CA gene in head and neck squamous cell carcinoma

Abstract: PIK3CA gene plays a crucial role in carcinogenesis in general and HNSCC in particular. The identification of five novel mutations suggest that Saudis may have different frequencies of somatic genetic alterations that may influence HNSCC compared to other populations.

Cited by 9 publications

References 32 publications

Tyrosine kinase domain mutations of <em>EGFR</em> gene in head and neck squamous cell carcinoma

Tyrosine kinase domain mutations of <em>EGFR</em> gene in head and neck squamous cell carcinoma

Helical and kinase domain mutations of PIK3CA, and their association with hormone receptor expression in breast cancer

Association of Uncoupling Protein 1 (UCP1) gene polymorphism with obesity: a case-control study

Contact Info

Product

Resources

About