Novel LC8 Mutations Have Disparate Effects on the Assembly and Stability of Flagellar Complexes

Abstract

LC8 functions as a dimer crucial for a variety of molecular motors and non-motor complexes. Emerging models, founded on structural studies, suggest that the LC8 dimer promotes the stability and refolding of dimeric target proteins in molecular complexes, and its interactions with selective target proteins, including dynein subunits, is regulated by LC8 phosphorylation, which is proposed to prevent LC8 dimerization. To test these hypotheses in vivo, we determine the impacts of two new LC8 mutations on the assembly and stability of defined LC8-containing complexes in Chlamydomonas flagella. The three types of dyneins and the radial spoke are disparately affected by dimeric LC8 with a C-terminal extension. The defects include the absence of specific subunits, complex instability, and reduced incorporation into the axonemal super complex. Surprisingly, a phosphomimetic LC8 mutation, which is largely monomeric in vitro, is still dimeric in vivo and does not significantly change flagellar generation and motility. The differential defects in these flagellar complexes support the structural model and indicate that modulation of target proteins by LC8 leads to the proper assembly of complexes and ultimately higher level complexes. Furthermore, the ability of flagellar complexes to incorporate the phosphomimetic LC8 protein and the modest defects observed in the phosphomimetic LC8 mutant suggest that LC8 phosphorylation is not an effective mechanism for regulating molecular complexes.

General and specific promotion of flagellar assembly by a flagellar nucleoside diphosphate kinase

“…Although mutations of flagellar genes are mostly recessive ( Luck et al ., 1977 ), based on the NDK5’s Dpy30 dimerization domain ( Sivadas et al ., 2012 ) and the DN effect observed for Drosophila NDK kpn and heteromeric oligomers ( Wilkie, 1994 ), we predicted that expression of inactive NDK5 might also elicit DN effects. Therefore we first engineered an NDK5-6His minigene with the regulatory elements of the LC8 gene, which encodes an abundant 10-kDa protein present in many molecular complexes, including RSs ( Yang et al ., 2009 ). We also built into the plasmid a paromomycin (PMM)-resistance cassette for selecting transformants.…”

“…Thus NDK5 H121A , rather than the abundance of His-tagged NDK5 proteins, likely accounted for the motility and length phenotype. While these results were consistent with those in the sperm of ndk5 mice, flagellar lengths in Chlamydomonas varied among the strains; in contrast, none of existing RS mutants was known to exhibit such a prominent length phenotype, except for the LC8 mutant ( fla14 ), whose short flagella were attributed to pleiotropic deficiencies in multiple flagellar complexes ( Pazour et al ., 1998 ; Yang et al ., 2009 ). We further investigated an ndk5 recessive mutant and generated genomic constructs to elucidate the role of NDK5 and to test the DN effect of NDK5 H121A independently.…”

“…2006 ). For expression in Chlamydomonas , the coding sequence for NDK5 and the His tag was PCR amplified, and the DNA fragment was used to replace the coding sequence of the LC8 genomic construct that also harbored a PMM-resistance cassette ( Yang et al ., 2009 ). The H121 codon in the NDK5 minigene was mutated to an alanine codon using site-directed mutagenesis and the following primer pair: NDKH2AS (GGCACCCAGAATGCCACCGCGGGCAGCGACTCGCC) and NDKH2AAS (GTAGGCGAGTCGCTGCCCGCGGTGGCATTCT­GGGTGCC).…”

Resonance assignments and secondary structure analysis of dynein light chain 8 by magic-angle spinning NMR spectroscopy

“…22 Moreover, the phosphomimetic LC8 mutant S88E is found to be dimeric in Chlamydomonas dynein, with no obvious functional deficiency caused by this mutation. 23 …”

Affinity, Avidity, and Kinetics of Target Sequence Binding to LC8 Dynein Light Chain Isoforms

“…Recently, a phosphomimetic S90E mutant of Chlamydomonas flagella LC8, which is analogous to the human DYNLL S88E mutant, was found to be largely monomeric in vitro but dimeric in vivo. This mutation did not cause significant change in flagellar generation and motility (49). The crystal structure of a homologous phosphomimetic DYNLL mutant bound to a fragment of swallow has also been determined (48).…”