Novel ITS1 Fungal Primers for Characterization of the Mycobiome

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh D.; Levi, Michael H.; Burk, Robert D.

doi:10.1128/msphere.00488-17

Cited by 92 publications

(86 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The fungal DNA ITS1 region was amplified using barcoded-primers ITS1_48F (ACACAC CGCCCGTCGCTACT) and ITS1_217R (TTTCGCTGCGTTCTTCATCG) as previously described [63]. PCR reactions were performed with 8.25 μl of nuclease-free PCR-grade water (Lonza), 2.5 μl of 10X Buffer w/ MgCl 2 (Affymetrix), 1 μl of MgCl 2 (25 mM, Affymetrix), 0.5 μl of dNTPs (10 mM, Roche), 0.25 μl of AmpliTaq Gold DNA Polymerase (5 U/μl, Applied Biosystems), 0.5 μl of HotStart-IT FideliTaq (2.5 U/μl, Affymetrix), 1μl of each primer (5 μM), and 10 μl of sample DNA.…”

Section: Microbiome and Hr-hpv Progressionmentioning

confidence: 99%

Cervicovaginal microbiome and natural history of HPV in a longitudinal study

et al. 2020

Self Cite

View full text Add to dashboard Cite

BackgroundHuman papillomavirus (HPV) infection is one of the most common sexually transmitted infections. However, only a small percentage of high-risk (HR) HPV infections progress to cervical precancer and cancer. In this study, we investigated the role of the cervicovaginal microbiome (CVM) in the natural history of HR-HPV. MethodsThis study was nested within the placebo arm of the Costa Rica HPV Vaccine Trial that included women aged 18-25 years of age. Cervical samples from two visits of women with an incident HR-HPV infection (n = 273 women) were used to evaluate the prospective role of the CVM on the natural history of HR-HPV. We focus specifically on infection clearance, persistence, and progression to cervical intraepithelial neoplasia grade 2 and 3 (CIN2+). The CVM was characterized by amplification and sequencing the bacterial 16S V4 rRNA gene region and the fungal ITS1 region using an Illumina MiSeq platform. OTU clustering was performed using QIIME2. Functional groups were imputed using PICRUSt and statistical analyses were performed using R. ResultsAt Visit 1 (V1) abundance of Lactobacillus iners was associated with clearance of incident HR-HPV infections (Linear Discriminant Analysis (LDA)>4.0), whereas V1 Gardnerella was PLOS PATHOGENS PLOS Pathogens | https://doi.

show abstract

Section: Microbiome and Hr-hpv Progressionmentioning

confidence: 99%

Cervicovaginal microbiome and natural history of HPV in a longitudinal study

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…2 [33]. The homology of ribosome encoding genes (18s, 5.8S, or 28S) allows the design of universal fungal ITS primers to amplify fragments containing either the ITS 1, ITS 2, or ITS 1 and 2 regions that can be differentiated to genus and even species taxonomic ranks [33–38]. As the genetic marker is a nuclear ribosomal repeat unit, there are multiple copies that provide up to 100-fold more templates compared to single-copy genes [33].…”

Section: Its Region Sequencingmentioning

confidence: 99%

“…However, several sequence amplification considerations within the analysis matrix could introduce selection biases and should be considered before utilizing ITS region sequencing methods. Examples of these limitations have been reviewed or discussed elsewhere and include primer design, sample extraction and purification, eukaryotic contamination, and homology of ITS region sequences within specific fungal orders, as well as various bioinformatic analyses and workflow considerations [33, 34, 38, 42–50]. …”

Section: Its Region Sequencingmentioning

confidence: 99%

Emerging Insights into the Occupational Mycobiome

Green

2018

Curr Allergy Asthma Rep

View full text Add to dashboard Cite

Purpose of Review The evolution of molecular-based methods over the last two decades has provided new approaches to identify and characterize fungal communities or “mycobiomes” at resolutions previously not possible using traditional hazard identification methods. The recent focus on fungal community assemblages within indoor environments has provided renewed insight into overlooked sources of fungal exposure. In occupational studies, internal transcribed spacer (ITS) region sequencing has recently been utilized in a variety of environments ranging from indoor office buildings to agricultural commodity and harvesting operations. Recent Findings Fungal communities identified in occupational environments have been primarily placed in the phylum Ascomycota and included classes typically identified using traditional fungal exposure methods such as the Eurotiomycetes, Dothideomycetes, Sordariomycetes, and Saccharomycetes. The phylum Basidiomycota has also been reported to be more prevalent than previously estimated and ITS region sequences have been primarily derived from the classes Agaricomycetes and Ustilaginomycetes. These studies have also resolved sequences placed in the Basidiomycota classes Tremellomycetes and Exobasidiomycetes that include environmental and endogenous yeast species. Summary These collective datasets have shown that occupational fungal exposures include a much broader diversity of fungi than once thought. Although the clinical implications for occupational allergy are an emerging field of research, establishing the mycobiome in occupational environments will be critical for future studies to determine the complete spectrum of worker exposures to fungal bioaerosols and their impact on worker health.

show abstract

“…For example, underrepresentation of Candida glabrata has been observed and is likely due to its 420 bp intron-containing amplicon being amplified with relatively less efficiency during PCR. In addition, primer coverage is not complete [85,86]. For example, one study failed to identify Sporothrix schenckii and Rhizomucor pusillus when using ITS1 due to a lack of primer compatibility.…”

Section: Sequencing Methodsologiesmentioning

confidence: 99%

The Human Lung Mycobiome in Chronic Respiratory Disease: Limitations of Methods and Our Current Understanding

Weaver

Gago

Bromley

et al. 2019

Curr Fungal Infect Rep

View full text Add to dashboard Cite

Purpose of the Review This review summarises the characteristics of the lung mycobiome in patients with chronic respiratory diseases and fungal lung diseases. We have also reviewed the limitations of the current methods in mycobiome studies. Recent Findings Available studies in the impacts of the mycobiome in chronic and fungal lung diseases are scarce and comparison of the available studies is hindered by heterogeneity in the sample sizes, methods and patient selection. Summary The impact of the diversity and composition of the lung mycobiome in chronic and fungal lung diseases is poorly understood. Most studies involve detection of fungi in respiratory samples by culture. However, such methods lack sensitivity and the emergence of next-generation sequencing technologies is an important advance. However, differences in the sequencing methodologies limit study comparisons. Well-designed methodological approaches and large cohort studies are needed to evaluate the impact of the lung mycobiome in respiratory diseases.

show abstract

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

Cited by 92 publications

References 48 publications

Cervicovaginal microbiome and natural history of HPV in a longitudinal study

Cervicovaginal microbiome and natural history of HPV in a longitudinal study

Emerging Insights into the Occupational Mycobiome

The Human Lung Mycobiome in Chronic Respiratory Disease: Limitations of Methods and Our Current Understanding

Contact Info

Product

Resources

About