Novel enhanced GFP‐positive congenic inbred strain establishment and application of tumor‐bearing nude mouse model

Abstract

This is an open access article under the terms of the Creat ive Commo ns Attri bution-NonCo mmerc ial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Proteomics analysis: inhibiting the expression of P62 protein by chloroquine combined with dacarbazine can reduce the malignant progression of uveal melanoma

“…The 92.1 UM cell line was derived from the human orbit and established by Waard-Siebinga ID et al [ 16 ] in 1995. In order to study whether the biological characteristics of ectopic (ventricular) growth (simulated metastasis) were more malignant, the 92.1 cell suspension was inoculated into the brain ventricle of EGFP transgenic nude mice[ 17 ], and the solid tumor model of intraventricular metastasis was successfully established (Fig. 2 ).…”

HOTAIRM1 Promotes Malignant Progression of Transformed Fibroblasts in Glioma Stem-Like Cells Remodeled Microenvironment via Regulating miR-133b-3p/TGFβ Axis

“…Balb/c nude mice expressing green fluorescent protein (GFP) were bred in specific pathogen free (SPF) experimental animal center in Soochow University ( 27 ). All of the animal studies adhered to the rules of the Ethics Committee of the Second Affiliated Hospital of Soochow University.…”

Integrative analysis of TP73 profile prognostic significance in WHO grade II/III glioma

“…Then, cDNA was synthesized with a First Strand cDNA Synthesis Kit (Thermo Scientific). qRT‐PCR was performed as previous report 26 . Each sample was run in triplicate, and the relative mRNA expression was calculated using the formula 2 −ΔΔCt by the comparative ΔΔCt method.…”

“…qRT‐PCR was performed as previous report. 26 Each sample was run in triplicate, and the relative mRNA expression was calculated using the formula 2 −ΔΔCt by the comparative ΔΔCt method. The primers used were as follows: TP73 (5’‐CCACCACTTTGAGGTCACTTT‐3’, 5’‐CTTCAAGAGCGGGGAGTACG‐3’); GAPDH (5’‐GAAGGTGAAGGTCGGAGTC‐3’, 5’‐GAAGATGGTGATGGGATTTC‐3’).…”