Novel Cytokines in the Treatment of Malignancies

Parihar, Robin; Carson, William E.

doi:10.1007/0-387-24361-5_15

Cited by 1 publication

(1 citation statement)

References 80 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RNA was converted to complementary DNA by reverse transcription and used as a template for RT-PCR using FR-α (forward primer, TGGGTGGCTGTAGTAGGGGAG; reverse primer, CAGGGGCACGTTCAGTACC) and FR-β primers (forward primer, ACCAATGCAGTCC-CTGGAAGAAGA; reverse primer, AGCTGGGCACTTGTTAACTCCTGA) [32]. The PCR conditions consisted of 95°C for 30s followed by 30 cycles of 95°C for 30s, 58°C for 30s, and 72°C for 40s.…”

Section: Methodsmentioning

confidence: 99%

Folate-conjugated immunoglobulin targets melanoma tumor cells for NK cell effector functions

Skinner¹,

McMichael²,

Jaime-Ramirez³

et al. 2016

Melanoma Research

Self Cite

View full text Add to dashboard Cite

The folate receptor (FR) is over-expressed on the vascular side of cancerous cells including those of the breast, ovaries, testes, and cervix. We hypothesized that a folate-conjugated immunoglobulin (F-IgG) would bind to the FR that is over-expressed on melanoma tumor cells to target these cells for lysis by natural killer (NK) cells. Folate receptor expression was confirmed in the Mel-39 (human melanoma) cell line by flow cytometry and immunoblot analysis, using KB (human oral epithelial) and F01 (human melanoma) as a positive and negative control, respectively. FR-positive and negative cell lines were treated with F-IgG or control immunoglobulin G (C-IgG) in the presence or absence of cytokines in order to determine NK cell ability to lyse FR-positive cell lines. NK cell activation was significantly upregulated and lysis of Mel 39 tumor cells enhanced following treatment with F-IgG, as compared to C-IgG at all effector:target (E:T) ratios (p<0.01). This trend was further enhanced by NK cell stimulation with the activating cytokine interleukin-12 (IL-12). NK cell production of cytokines such as interferon-gamma (IFN-γ), macrophage inflammatory protein 1 alpha (MIP-1α), and regulated on activation normal T-cell expressed and secreted (RANTES) were also significantly increased in response to co-stimulation with IL-12 stimulation and F-IgG-coated Mel 39 target cells, as compared to controls (p<0.01). In contrast, F-IgG did not bind to the FR-negative cell line F01 and had no significant effect on NK cell lysis or cytokine production. This research indicates the potential use of F-IgG for its ability to induce an immune response from NK cells against FR-positive melanoma tumor cells which can be further enhanced by the addition of cytokines.

show abstract

Section: Methodsmentioning

confidence: 99%