Novel cholinergic peptides SLURP‐1 and ‐2 regulate epithelialization of cutaneous and oral wounds

Abstract

It is well established that auto/paracrine acetylcholine (ACh) is essential for wound epithelialization, and that the mechanisms include regulation of keratinocyte motility and adhesion via nicotinic ACh receptors (nAChRs). Keratinocyte nAChRs can be also activated by non-canonical ligands, such as secreted mammalian Ly-6/urokinase-type plasminogen activator receptor-related protein (SLURP)-1 and -2. In this study, we determined effects of recombinant (r)SLURP-1 and-2 on migration of human epidermal and oral keratinocytes under agarose and epithelialization of cutaneous and mucosal excisional wounds in mice, and also identified nAChRs mediating SLURP signals. Both in vitro and in vivo, rSLURP-1 decreased and SLURP-2 increased epithelialization rate. The mixture of both peptides accelerated epithelialization even further, indicating that their simultaneous signaling renders an additive physiologic response. The specificity of rSLURP actions was illustrated by similar effects on cutaneous and oral wounds, which feature distinct responses to injury, and also by abrogation of rSLURP effects with neutralizing antibodies. rSLURP-1 acted predominantly via the α7 nAChR-coupled upregulation of the sedentary integrins α2 and α3, whereas SLURP-2—through α3, and α9 nAChRs upregulating migratory integrins α5 and αV. The biologic effects of rSLURPs required the presence of endogenous ACh, indicating that auto/paracrine SLURPs provide for a fine tuning of the physiologic regulation of crawling locomotion via the keratinocyte ACh axis. Since nAChRs have been shown to regulate SLURP production, cholinergic regulation of keratinocyte migration appears to be mediated by a reciprocally arranged network. The cholinergic peptides, therefore, may become prototype drugs for the treatment of wounds that fail to heal.

Molecular mechanisms of synergy of corneal muscarinic and nicotinic acetylcholine receptors in upregulation of E-cadherin expression

“…For transfection of CEC with the HuSH-29™ predesigned shRNA plasmids specific for human M 3 and M 4 mAChR subtypes and α3, α7 and α9 nAChR subunit genes, we followed a standard protocol described by us in detail elsewhere [28]. Briefly, one day before transfection CEC were seeded at a density of 1 × 10 4 cells per well of the 96-well in-cell western (ICW) plates and exposed to experimental, i.e., mAChR subtype-or nAChR subunit gene-specific shRNA or shRNA-NC plasmids in GIBCO™ Opti-MEM I Reduced-Serum Medium (Invitrogen, Carlsbad, CA) with a transfection reagent from Mirus Bio LLC (Madison, WI).…”

Role of Lynx1 and related Ly6 proteins as modulators of cholinergic signaling in normal and neoplastic bronchial epithelium

“…Additional evidence for the importance of the ly-6 proteins in epithelial functioning is provided by the work of Grando and co-workers who have shown that slurp-2 stimulated keratinocyte proliferation, migration and inhibited apoptosis, potentially acting through the α3 nAChR [19,39]. By contrast slurp-1 appears to stimulate apoptosis of keratinocytes [40].…”

The nicotinic acetylcholine receptor-mediated reciprocal effects of the tobacco nitrosamine NNK and SLURP-1 on human mammary epithelial cells

“…For quantitative real-time (q)PCR, we used primers for α7 (cgcaaccactcaccgtctacttct and cacccctggatattctgacacatt) and α9 (aagtgctgacgaggaata and tgtgactaatccgctctt) nAChR subunits and reaction conditions described by us in the past [40]. The PCR array experiments were performed using the RT 2 -Profiler PCR Array for Human Oncogenes & Tumor Suppressor genes (PAHS-502E, SABiosciences) and ABI Prism 7900 HT (Applied Biosystems, Carlsbad, CA), as detailed by us elsewhere [41].…”