Notchless-dependent ribosome synthesis is required for the maintenance of adult hematopoietic stem cells

Bouteiller, Marie Le; Souilhol, Céline; Beck-Cormier, Sarah; Stedman, Aline; Burlen-Defranoux, Odile; Vandormael-Pournin, Sandrine; Bernex, Florence; Cumano, Ana; Cohen-Tannoudji, Michel

doi:10.1084/jem.20122019

Cited by 34 publications

(44 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…23 Contrary to Drosophila, 38 Nle loss of function does not seem to interfere with the Notch pathway in the mouse hematopoietic 23 and intestinal (this study) lineages. Indeed, although increasing or decreasing Notch activity systematically results in strong variations of Hes1 expression levels in the intestinal crypt cells, [39][40][41][42][43] Hes1 mRNA levels were unchanged following Nle inactivation in the intestinal epithelium (Figure 3c and data not shown).…”

Section: Discussionmentioning

confidence: 51%

“…[20][21][22] We recently showed that Nle role in the maturation of the large ribosomal subunit is conserved in mouse and that Nle is required for the maintenance of hematopoietic stem cells. 23 During the course of this study, we noticed that the gut was also sensitive to Nle deletion. Here we performed the conditional inactivation of Nle in the intestinal epithelium and showed that Nle-dependent large ribosomal subunit biogenesis is required for the maintenance of intestinal stem cells (ISCs) and progenitors.…”

mentioning

confidence: 75%

“…56 Future investigations using the NleVilcKO model will help to obtain a deeper understanding on the mechanisms that link ribosomes biogenesis to intestinal cancer. 23 Nle null , 24 Villin-CreERT2, 57 Lgr5 GFP-IRES-CreERT2 , 58 p53 − . 59 To generate Control and NleVilcKO mice, Villin-CreERT2 tg/tg ; Nle flox/flox mice were crossed to Nle null/+ mice.…”

Section: Discussionmentioning

confidence: 99%

“…62 Conjugated FISH probes were purchased from Eurogentec: its1-Cy5: tagacacggaagagccggacgggaaaga; its2-Cy3: gcgattgatcgtcaaccgacgctc; 28S-Alexa488: cccgttcccttggctgtggtttcgctggata; 18S-Cy5: tttacttcctctagatagtcaagttc gacc and validated in a previous study. 23 Crypts culture. Isolated crypts were cultured as previously described.…”

Section: Discussionmentioning

confidence: 99%

See 3 more Smart Citations

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

et al. 2015

View full text Add to dashboard Cite

International audienceRibosome biogenesis is an essential cellular process. Its impairment is associated with developmental defects and increased risk of cancer. The in vivo cellular responses to defective ribosome biogenesis and the underlying molecular mechanisms are still incompletely understood. In particular, the consequences of impaired ribosome biogenesis within the intestinal epithelium in mammals have not been investigated so far. Here we adopted a genetic approach to investigate the role of Notchless (NLE), an essential actor of ribosome biogenesis, in the adult mouse intestinal lineage. Nle deficiency led to defects in the synthesis of large ribosomal subunit in crypts cells and resulted in the rapid elimination of intestinal stem cells and progenitors through distinct types of cellular responses, including apoptosis, cell cycle arrest and biased differentiation toward the goblet cell lineage. Similar observations were made using the rRNA transcription inhibitor CX-5461 on intestinal organoids culture. Importantly, we found that p53 activation was responsible for most of the cellular responses observed, including differentiation toward the goblet cell lineage. Moreover, we identify the goblet cell-specific marker Muc2 as a direct transcriptional target of p53. Nle-deficient ISCs and progenitors disappearance persisted in the absence of p53, underlying the existence of p53-independent cellular responses following defective ribosome biogenesis. Our data indicate that NLE is a crucial factor for intestinal homeostasis and provide new insights into how perturbations of ribosome biogenesis impact on cell fate decisions within the intestinal epithelium

show abstract

Section: Discussionmentioning

confidence: 51%

mentioning

confidence: 75%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

et al. 2015

View full text Add to dashboard Cite

show abstract

“…nle1 and wdr12 are involved in the biogenesis of ribosomal pre-60S particles. Interestingly, nle1 is also required for the maintenance of adult hematopoietic stem cells (HSCs) in mice, as shown by conditional knockouts (Le Boutellier et al, 2013).…”

Section: A Large Pml-specific Gene Network Encodes Nucleolar Proteinsmentioning

confidence: 99%

Zebrafish midbrain slow-amplifying progenitors exhibit high levels of transcripts for nucleotide and ribosome biogenesis

et al. 2013

View full text Add to dashboard Cite

Investigating neural stem cell (NSC) behaviour in vivo, which is a major area of research, requires NSC models to be developed. We carried out a multilevel characterisation of the zebrafish embryo peripheral midbrain layer (PML) and identified a unique vertebrate progenitor population. Located dorsally in the transparent embryo midbrain, these large slow-amplifying progenitors (SAPs) are accessible for long-term in vivo imaging. They form a neuroepithelial layer adjacent to the optic tectum, which has transitory fast-amplifying progenitors (FAPs) at its margin. The presence of these SAPs and FAPs in separate domains provided the opportunity to data mine the ZFIN expression pattern database for SAP markers, which are coexpressed in the retina. Most of them are involved in nucleotide synthesis, or encode nucleolar and ribosomal proteins. A mutant for the cad gene, which is strongly expressed in the PML, reveals severe midbrain defects with massive apoptosis and sustained proliferation. We discuss how fish midbrain and retina progenitors might derive from ancient sister cell types and have specific features that are not shared with other SAPs.

show abstract

Emerging roles of nucleolar and ribosomal proteins in cancer, development, and aging

Takada

Kurisaki

2015

Cell. Mol. Life Sci.

View full text Add to dashboard Cite

Changes in nucleolar morphology and function are tightly associated with cellular activity, such as growth, proliferation, and cell cycle progression. Historically, these relationships have been extensively examined in cancer cells, which frequently exhibit large nucleoli and increased ribosome biogenesis. Recent findings indicate that alteration of nucleolar activity is a key regulator of development and aging. In this review, we have provided evidences that the nucleolus is not just a housekeeping factor but is actively involved in the regulation of cell proliferation, differentiation, and senescence both in vitro and in vivo. In addition, we have discussed how alteration of nucleolar function and nucleolar proteins induces specific physiological effects rather than widespread effects.

show abstract

Notchless-dependent ribosome synthesis is required for the maintenance of adult hematopoietic stem cells

Abstract: Conditional deletion of Notchless leads to rapid deletion and exhaustion of HSCs and early progenitor cells, whereas committed progenitor cells survive as a result of differences in ribosomal biogenesis.

Cited by 34 publications

References 70 publications

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

Ribosome biogenesis dysfunction leads to p53-mediated apoptosis and goblet cell differentiation of mouse intestinal stem/progenitor cells

Zebrafish midbrain slow-amplifying progenitors exhibit high levels of transcripts for nucleotide and ribosome biogenesis

Emerging roles of nucleolar and ribosomal proteins in cancer, development, and aging

Contact Info

Product

Resources

About