Non-radioactive southern hybridization for early diagnosis of ?-thalassemia with Southeast Asian-type deletion in Taiwan

Abstract

Alpha-thalassemia has been estimated to account for over 60% of hydrops fetalis cases in Taiwan. The most common genotypic lesion found in alpha-thalassemia-1 cases in Taiwan is deletion of a large segment of the alpha-globin gene cluster, termed the Southeast Asian-type deletion (-SEA/; further referred to as SEA-type deletion). Seven chorionic villus samples (CVS) from pregnancies of couples both heterozygous for SEA-type deletion were studied. Non-radioactive Southern-blot hybridization using the dig-alkaline phosphatase detection system was developed to fulfill this purpose. The results were compared with corresponding polymerase chain reaction (PCR) data to elucidate the effectiveness of these two protocols in the diagnosis of the SEA-type deletion. The data showed that of the seven CVS, three demonstrated a distinctive band pattern, indicating their homozygous status of SEA-type deletion, whereas two showed heterozygous patterns, and the other two were free of the deletion. Homozygosity of the deletion was confirmed by Southern-blot hybridization performed on DNA samples extracted from the abortus tissue. However, two of the three cases with SEA-type deletion showed heterozygous PCR results. Maternal cell contamination could be responsible for the artifacts in the PCR results, but the influence due to the contamination is minimal in non-radioactive Southern-blot hybridization. We concluded that PCR is suitable for screening of carrier adults with SEA-type deletion, and non-radioactive Southern hybridization is ideal for early prenatal diagnosis of the SEA-type deletion.

Microsatellite Markers within —SEA Breakpoints for Prenatal Diagnosis of HbBarts Hydrops Fetalis

“…In -SEA , the most common ␣-globin gene deletions encountered are the single gene deletions, -␣ 3.7 and -␣ 4.2 , and the double gene deletions in cis, -SEA , -FIL , and -THAI . The -MED and -(␣) 20.5 double-gene deletions are more prevalent in the Mediterranean region. Because these deletions are regionally specific (12 ), programs of screening, genetic counseling, and prenatal diagnosis of specific mutations have been developed for individual regions (13,14 ).…”

“…Southern blot analysis (19,20 ), formerly the standard method to detect gene deletions, is time-consuming, laborious, and technically demanding; with a limited detection rate of 60%-80%, this method is not suitable for large-scale screening (21 ). DNA sequence analysis of each deletion breakpoint has now enabled PCR-based testing (22)(23)(24)(25)(26).…”

Real‐time quantitative PCR analysis for α‐thalassemia‐1 of Southeast Asian type deletion in Taiwan

“…DNA samples were stored at −20°C until assay. Genotypes of all cases were confirmed with conventional PCR analysis in the current thalassemia screening protocol [1].…”

“…The amplification was carried out in a reaction volume of 25 μl containing 12.5 μl of the 2× TaqMan PCR master mix (Applied Biosystems, Foster City, CA, USA), 20 pmol each of the primers (S1/S2 for the wild‐type α‐globin gene alleles, and S1/S3 for the SEA type deletions; Fig. 1) [1,10], 10 pmol of the TaqMan probe (5′‐FAM‐TCGCAGGAACTCGGTCGTCCCCACTGTCGT‐TAMRA‐3′), and 0.5 μl distilled water. The mixture was preheated at 95°C for 10 min and then cycled 40 times at 95°C, 1 min, and 60°C, 2 min in a Gene Amp 5700 sequence detection system (Applied Biosystems).…”

Rapid, accurate genotyping of the common −α4.2thalassaemia deletion based on the use of denaturing HPLC

“…7 In recent years, several techniques for the molecular characterisation of common a thalassaemia deletions have been described. [8][9][10][11] The Gap-polymerase chain reaction (PCR) technique, based on the amplification of the junction segment of the breakpoint, is a notable example. However, there are problems with the reproducibility of this technique because PCR does not perform well for relatively long fragments with high G/C content.…”