No association between p53 status and alpha-particle-induced chromosomal instability in human lymphoblastoid cells

Ma, Kadhim; Ca, Walker; Ma, Plumb; Wright, E. A.

doi:10.1080/095530096145995

Cited by 30 publications

(8 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The radiation-induced chromosomal instability and delayed HR observed in irradiated p53 ϩ RKO36 cells are consistent with prior studies showing that delayed instability is not restricted to p53-defective cells (15,29).…”

Section: Discussionsupporting

confidence: 78%

Ionizing Radiation Induces Delayed Hyperrecombination in Mammalian Cells

Huang

Grim

Smith

et al. 2004

Molecular and Cellular Biology

View full text Add to dashboard Cite

Exposure to ionizing radiation can result in delayed effects that can be detected in the progeny of an irradiated cell multiple generations after the initial exposure. These effects are described under the rubric of radiation-induced genomic instability and encompass multiple genotoxic endpoints. We have developed a green fluorescence protein (GFP)-based assay and demonstrated that ionizing radiation induces genomic instability in human RKO-derived cells and in human hamster hybrid GM10115 cells, manifested as increased homologous recombination (HR). Up to 10% of cells cultured after irradiation produce mixed GFP ؉/؊ colonies indicative of delayed HR or, in the case of RKO-derived cells, mutation and deletion. Consistent with prior studies, delayed chromosomal instability correlated with delayed reproductive cell death. In contrast, cells displaying delayed HR showed no evidence of delayed reproductive cell death, and there was no correlation between delayed chromosomal instability and delayed HR, indicating that these forms of genome instability arise by distinct mechanisms. Because delayed hyperrecombination can be induced at doses of ionizing radiation that are not associated with significantly reduced cell viability, these data may have important implications for assessment of radiation risk and understanding the mechanisms of radiation carcinogenesis.

show abstract

Section: Discussionsupporting

confidence: 78%

Ionizing Radiation Induces Delayed Hyperrecombination in Mammalian Cells

Huang

Grim

Smith

et al. 2004

Molecular and Cellular Biology

View full text Add to dashboard Cite

show abstract

“…These are regarded as delayed effects resulting from transmission of genomic instability to the progeny of treated cells. Characteristically, it is induced at frequencies greater than that of natural spontaneous mutations (Kadhim et al, 1996). Once induced, genomic instability is effectively permanent and has been shown to persist in vitro and in vivo for many cell doublings (Seymour et al, 1986;O'Reilly et al, 1994;Watson et al, 1996).…”

mentioning

confidence: 99%

Particulate debris from a titanium metal prosthesis induces genomic instability in primary human fibroblast cells

Coen¹,

Kadhim

Wright

et al. 2003

Br J Cancer

View full text Add to dashboard Cite

Previous studies detected both lethal and cumulative chromosomal aberrations in bone marrow and peripheral blood of patients with worn hip and knee replacements. This study shows that wear debris from a worn titanium metal on high-density polyethylene hip replacement also produces chromosomal instability and reproductive failure in cell culture. The progeny of these treated cells also displayed chromosomal instability, mainly consisting of chromatid breaks and minutes, and reproductive failure as determined by clonogenic survival many generations postexposure. These delayed effects are similar to those caused by the heavy metals cadmium and nickel and to those seen for low-dose radiation. These findings may have important implications with regard to the long-term risks of joint replacement surgery. This highlights the need for long-term epidemiological studies of patients with surgical implants.

show abstract

“…Double-stranded oligonucleotides containing p53 (GGACATGCCCGGGCATGTCC), 40 NF-B (CAAC GGCAGGGGAATTCCCCTCTCCTT), 30 and AP1 (CTCGATGCCATGACTCATCTTTAC) 36 consensus recognition sequences were as described.…”

Section: Electrophoretic Mobility Shift Assaysmentioning

confidence: 99%

“…Binding reactions were incubated on ice for 90 min and then resolved by non-denaturing 5 per cent (w/v) polyacrylamide/0·2 TBE gel electrophoresis and autoradiography. 30,36,40 …”

Section: Electrophoretic Mobility Shift Assaysmentioning

confidence: 99%