Nitrogen removal characteristics of indigenous aerobic denitrifiers and changes in the microbial community of a reservoir enclosure system via in situ oxygen enhancement using water lifting and aeration technology

Abstract

Indigenous aerobic denitrifiers of a reservoir system were enhanced in situ by water lifting and aeration technology. Nitrogen removal characteristics and changes in the bacterial community were investigated. Results from a 30-day experiment showed that the TN in the enhanced water system decreased from 1.08-2.02 to 0.75-0.91mg/L and that TN removal rates varied between 21.74% and 52.54% without nitrite accumulation, and TN removal rate of surface sediments reached 41.37±1.55%. The densities of aerobic denitrifiers in the enhanced system increased. Furthermore, the enhanced system showed a clear inhibition of Fe, Mn, and P performances. Community analysis using Miseq showed that diversity was higher in the in situ oxygen enhanced system than in the control system. In addition, the microbial composition was significantly different between systems. It can be concluded that in situ enhancement of indigenous aerobic denitrifiers is very effective in removing nitrogen from water reservoir systems.

Removing ammonium from underground water by strengthening Mn(III) generation through electrochemical reduction

“…The genera including novosphingobium (12%), acinetobacter (8%), and pseudomonas (2%) were found in MnO x /AC, and they were well known for their capability of denitrifications. Moreover, novosphingobium and pseudomonas were also found recently by Zhou et al (2016) in oligotrophic reservoir water and they converted NO − 3 − N to N 2 even in the water with DO concentration as high as 7-10 mg/L (Ji, Wang, & Yang, 2014;Zhou et al, 2016). The filter, which provided the MnO x /AC in this study, was filled with oligotrophic groundwater with a DO concentration similar to that in the work (Zhou et al, 2016).…”

“…Moreover, novosphingobium and pseudomonas were also found recently by Zhou et al. () in oligotrophic reservoir water and they converted to N 2 even in the water with DO concentration as high as 7–10 mg/L (Ji, Wang, & Yang, ; Zhou et al., ). The filter, which provided the MnO x /AC in this study, was filled with oligotrophic groundwater with a DO concentration similar to that in the work (Zhou et al., ).…”

“…() in oligotrophic reservoir water and they converted to N 2 even in the water with DO concentration as high as 7–10 mg/L (Ji, Wang, & Yang, ; Zhou et al., ). The filter, which provided the MnO x /AC in this study, was filled with oligotrophic groundwater with a DO concentration similar to that in the work (Zhou et al., ). Thus, the aerobic denitrification bacteria detected in this study should be related to the high DO concentration.…”

“…To explore the microbial community composition in MnO x /AC, the Illumina Miseq Sequencing was performed according to reference (Zhang, Feng, et al., ; Zhang, Wang, et al., ; Zhou et al., ). In detail, DNA extracted from MnO x /AC was amplified by PCR using Primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 338R (5′‐TGCTGCCTCCCGTAGGAGT‐3′).…”

Consumption of ammonia-nitrogen by aob in immobilized batch culture

“…The existence of nitrogen in water has increased due to the rapidly growing population [1]. The ammonia-nitrogen in the water leads to poor water quality which will harm aquatic organisms especially fish [2]. Hence, a stringent water quality standard has been introduced in developed countries, especially in the United Kingdom [3] to limit the existence of pollutants in the river.…”