Nicotinamide Adenine Dinucleotide-Dependent Binding of the Neuronal Ca²⁺Sensor Protein GCAP2 to Photoreceptor Synaptic Ribbons

Abstract

Guanylate cyclase activating protein 2 (GCAP2) is a recoverin-like Ca2+-sensor protein known to modulate guanylate cyclase activity in photoreceptor outer segments. GCAP2 is also present in photoreceptor ribbon synapses where its function is unknown. Synaptic ribbons are active zone-associated presynaptic structures in the tonically active photoreceptor ribbon synapses and contain RIBEYE as a unique and major protein component. In the present study, we demonstrate by various independent approaches that GCAP2 specifically interacts with RIBEYE in photoreceptor synapses. We show that the flexible hinge 2 linker region of RIBEYE(B) domain that connects the nicotinamide adenine dinucleotide (NADH)-binding subdomain with the substrate-binding subdomain (SBD) binds to the C terminus of GCAP2. We demonstrate that the RIBEYE–GCAP2 interaction is induced by the binding of NADH to RIBEYE. RIBEYE–GCAP2 interaction is modulated by the SBD. GCAP2 is strongly expressed in synaptic terminals of light-adapted photoreceptors where GCAP2 is found close to synaptic ribbons as judged by confocal microscopy and proximity ligation assays. Virus-mediated overexpression of GCAP2 in photoreceptor synaptic terminals leads to a reduction in the number of synaptic ribbons. Therefore, GCAP2 is a prime candidate for mediating Ca2+-dependent dynamic changes of synaptic ribbons in photoreceptor synapses.

A Calcium-Relay Mechanism in Vertebrate Phototransduction

“…76,77 Further, overexpression of GCAP2 leads to morphological changes of the ribbon synapse. 78 Does GCAP2 operate as a Ca…”

The Synaptic Ribbon Is a Site of Phosphatidic Acid Generation in Ribbon Synapses

“…Tryptophan anchoring phosphatidic acid-selective binding domain-1 PA-sensor constructs pSFV1-EGFP was generated as described previously (Venkatesan et al, 2010). The EGFP encoding insert was amplified via PCR with forward primer (986) TTTAGATCTGCCACCATGGTGAGCAAGGGCGA and reverse primer (987) TTTGGATCCCTTGTACAGCTCGTCCAT, and subsequently cloned into the BamHI site of pSFV1 (Ashery et al, 1999;Venkatesan et al, 2010).…”

“…The EGFP encoding insert was amplified via PCR with forward primer (986) TTTAGATCTGCCACCATGGTGAGCAAGGGCGA and reverse primer (987) TTTGGATCCCTTGTACAGCTCGTCCAT, and subsequently cloned into the BamHI site of pSFV1 (Ashery et al, 1999;Venkatesan et al, 2010). Orientation was checked by double digestion with EcoRI/BamHI and verified by sequencing.…”

“…Recombinant Semliki Forest (SLF) viruses were generated as described previously (Ashery et al, 1999;Venkatesan et al, 2010). In brief, recombinant pSFV1 plasmids were linearized with SpeI.…”

“…After 24 h in culture at 31°C (5% CO 2 ), the virus was harvested. Virus titer and activation of virus were determined as described previously (Ashery et al, 1999;Venkatesan et al, 2010).…”