NF-κB signaling pathway is inhibited by heat shock independently of active transcription factor HSF1 and increased levels of inducible heat shock proteins

Abstract

NF-jB transcription factor regulates numerous genes important for inflammation, immune responses and cell survival. HSF1 is the primary transcription factor activated under stress conditions that is responsible for induction of genes encoding heat shock proteins. Previous studies have shown that the NF-jB activation pathway is blocked by heat shock possibly involving heat shock proteins. Here, we investigate whether active HSF1 inhibited this pathway in the absence of stress conditions. Activation of the NF-jB pathway and expression of NF-jBdependent genes were analyzed in TNFa-stimulated U-2 OS human osteosarcoma cells that were either heat-shocked or engineered to express a constitutively active form of HSF1 in the absence of heat shock. As expected, heat shock resulted in a general blockade in the degradation of the IjBa inhibitor, nuclear translocation of NF-jB and expression of NF-jB-dependent target genes. In marked contrast, the presence of constitutively active HSF1 did not block TNFa-induced activation of the NF-jB pathway or expression of a set of the NF-jB-dependent genes. We conclude that in the absence of heat shock, the NF-jB activation pathway is inhibited by neither active HSF1 transcription factor nor by increased levels of HSF1-induced heat shock proteins.

Active heat shock transcription factor 1 supports migration of the melanoma cells via vinculin down-regulation

“…In the present work we used cells expressing a constitutively-active transcriptionally-competent form of HSF1 (aHSF1) [14,26,39,40] to study the influence of HSF1 activation on phenotype of cancer cells. We proved that the expression of aHSF1 allowed a developing thermotolerance in melanoma cells, resembling the function of endogenous heat-activated HSF1, which validated our experimental model.…”

“…The aHSF1 sequence was re-cloned into the pLNCX2 retrovirus expression vector (Clontech) downstream of the CMV promoter [14]. The target sequences for knock-down of mouse Hsf1 gene were as follows: HSF1-1 (1856-1876, NM_008296.2)-5′ GCTGCATACCTGCTGCCTTTA; and HSF1-2 (341-359, NM_008296.2)-5′AGCACAACAACATGGCTAG.…”

Chicken IL‐6 is a heat‐shock gene

“…Furthermore, IL‐6 was shown to be a direct target of HSF1 [16,17]. Although HSF1 binding does not necessarily affect the transcription of IL‐6 , it has been reported to suppress IL‐6 expression by inducing activating transcription factor 3 (ATF3) [18–21], a negative regulator of inflammatory cytokines including IL‐6 [22]. Thus, HSF1 plays an important role in a feedback regulation of the febrile response in mammals, which includes fever and the inflammatory response [2].…”

Irradiation withUV‐C inhibitsTNF‐α‐dependent activation of theNF‐κB pathway in a mechanism potentially mediated by reactive oxygen species

“…There were several reports that the heat shock‐induced HSR resulted in the suppression of the TNF‐α‐activated NF‐κB pathway (Knowlton ; Janus et al . , ). Thus, we assessed whether HSR was induced in the HCT116 cells irradiated with UV‐C.…”

“…Among the key stress-induced pathways, there is the so-called heat shock response (HSR), which depends on the activation and accumulation of the heat shock proteins (HSPs) in proteotoxic conditions. There were several reports that the heat shock-induced HSR resulted in the suppression of the TNF-a-activated NF-jB pathway (Knowlton 2006;Janus et al 2011Janus et al , 2015. Thus, we assessed whether HSR was induced in the HCT116 cells irradiated with UV-C.…”