Next Generation of Tn 7 -Based Single-Copy Insertion Elements for Use in Multi- and Pan-Drug-Resistant Strains of Acinetobacter baumannii

Abstract

The purpose of this study was to create single-copy gene expression systems for use in genomic manipulations of multidrug-resistant (MDR) and extensively drug-resistant (XDR) clinical isolates of Acinetobacter baumannii. In this study, mini-Tn7 vectors with zeocin and apramycin selection markers were created by cloning the ble and aac(3)-IV genes, respectively, enabling either inducible gene expression (pUC18T-mini-Tn7T-Zeo-LAC and pUC18T-mini-Tn7T-Apr-LAC) or expression from native or constitutive promoters (pUC18T-mini-Tn7T-Zeo and pUC18T-mini-Tn7T-Apr). The selection markers of these plasmids are contained within a Flp recombinase target (FRT) cassette, which can be used to obtain unmarked mini-Tn7 insertions upon introduction of a source of Flp recombinase. To this end, site-specific excision vectors pFLP2A and pFLP2Z (containing apramycin and zeocin selection markers, respectively) were created in this study as an accessory to the mini-Tn7 vectors described above. Combinations of these novel mini-Tn7 plasmids and their compatible pFLP2Z or pFLP2A accessory plasmid were used to generate unmarked insertions in MDR clinical isolates of A. baumannii. In addition, several fluorescent markers were cloned and inserted into MDR and XDR clinical isolates of A. baumannii via these apramycin and zeocin mini-Tn7 constructs to demonstrate their application. IMPORTANCE Acinetobacter baumannii is a high-priority pathogen for which research on mechanisms of resistance and virulence is a critical need. Commonly used antibiotic selection markers are not suitable for use in MDR and XDR isolates of A. baumannii due to the high antibiotic resistance of these isolates, which poses a barrier to the study of this pathogen. This study demonstrates the practical potential of using apramycin and zeocin mini-Tn7-and Flp recombinase-encoded constructs to carry out genomic manipulations in clinical isolates of A. baumannii displaying MDR and XDR phenotypes.

Characterization of RelA inAcinetobacter baumannii

“…A wild-type copy of the relA gene with its native ribosome binding site was generated by PCR using the primers AGGAGAATGGTATGGTCACAGTACG and ACTCTCAACAATAAGTCCCCAG. This PCR-generated fragment was then cloned into the SmaI site of pUC18Tn7 LAC Apr (kindly provided by Ayush Kumar at the University of Manitoba) (59). A recombinant containing the relA gene in the correct orientation such that expression could be driven by the IPTG-inducible tac promoter was electroporated along with a plasmid containing the Tn7 transposase (pTNS2) into the ΔrelA mutant.…”

Recent Advances in Genetic Tools for Acinetobacter baumannii

“…For example, those with a temperature-sensitive replicon ( Choi et al, 2008 ) allow for greater ease of selection after the first recombination event. The modifications in the original Flp-recombinase containing vectors has allowed for their use in hyper-resistant clinical isolates of A. baumannii ( Ducas-Mowchun et al, 2019 ).…”

“…A host of current strategies are beneficial in manipulation of A. baumannii laboratory-strains, including ATCC ® 17978 TM and ATCC ® 19606 T , but may be insufficient when targeting strains obtained from hospitals and patients more recently, primarily due to their high resistance to antibiotics and the genomic diversity of A. baumannii ( Diancourt et al, 2010 ; Zarrilli et al, 2013 ). Recently, genetic tools including the use of non-clinical antibiotic markers as well as those utilizing non-antibiotic markers have been generated for clinical strains of A. baumannii ( Trebosc et al, 2016 , 2019 ; Ducas-Mowchun et al, 2019 ; Lucidi et al, 2019 ). Many of these tools provide desirable traits in gene manipulation, including unmarked and scarless gene deletions, and complementation that mimic natural systems with no pleiotropic effects.…”

One-Step Engineering of a Stable, Selectable Marker-Free Autoluminescent Acinetobacter baumannii for Rapid Continuous Assessment of Drug Activity

“…S1A) containing both the luxCDABE operon and Tn7 [12] was utilized. Although this vector harbors a Flp recombinase target (FRT) cassette which can be used to obtain marker-free Tn7 insertions upon introduction of a Flp recombinase [13], the inconvenience of introduction and subsequent removal of the Flp recombinase renders the Flp/FRT system less appropriate. Instead, we utilized the Xer site-specific recombination system in which the removal of resistance genes is dependent on dif sequences and the endogenous Xer proteins only [14,15].…”

“…After verification by sequencing (BGI, Shenzhen, China), this plasmid was co-electroporated with a helper plasmid pTNS3 (Table S2) into Ab competent cells freshly prepared as described earlier [17], followed by selection on LB solid media with 100 µg ml (Table 1) to identify the insertion site. We considered clones yielding an RLU value of ≥10 5 and a PCR product of 368 bp as autoluminescent Abs (AlAb) [13] (Figs. 1A and 1B).…”