New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12

Abstract

The increase in genome scanning data, derived from clinical genetics practice, is producing a wealth of information on human sequence variability. The critical issue is to identify if a given nucleotide change results in a benign polymorphism or a disease-causing mutation. We have focused on one specific gene expression step, pre-mRNA processing, where we can functionally define the effect of nucleotide changes and in turn the patient's mutation can shed light on the basic pre mRNA splicing mechanisms. Our results show that several nucleotide changes in CFTR exon 12 induce a variable extent of exon skipping that leads to reduced levels of normal transcripts. This is the case in both natural mutations D565G and G576A (the latter having previously considered a neutral polymorphism) and several site-directed silent substitutions. We demonstrate here that this phenomenon is due to the interference with a new regulatory element that we have named composite exonic regulatory element of splicing (CERES). The effect of single nucleotide substitutions at CERES cannot be predicted by neither SR matrices nor enhancer identification. The recognition and characterization of splicing abnormalities, caused by exon sequence variations at CERES elements, may represent a frequent disease-causing mechanism that also relates to the phenotypic variability. Our results indicate that even the most benign looking polymorphism in an exon cannot be ignored as it may affect the splicing process. Hence, appropriate functional splicing assays should be included in genotype screenings to distinguish between polymorphisms and pathogenic mutations.

Splicing of a Critical Exon of Human Survival Motor Neuron Is Regulated by a Unique Silencer Element Located in the Last Intron

“…Generally, 1.0 g of total RNA was used per 20 l of reaction mixture. Minigene-specific spliced products were subsequently amplified with Taq polymerase (Invitrogen) and the following primer combinations: P1 (5Ј-CGACTCACTATAGGCTAGCC-3Ј) and P2 (5Ј-GCATGCAAGCTTCCTTTTTTCTTTCCCAACAC-3Ј) for SMN minigenes (50), alfa-23 (5Ј-CAACTTCAAGCTCCTAAGCCACTGC-3Ј) and BRA2 (5Ј-T AGGATCCGGTCACCAGGAAGTTGGTTAAATCA-3Ј) for CFTR and apoA-II minigenes (36,45,46), FP (5Ј-GGTGTCCACTCCCAGTTCAA-3Ј) and RP (5Ј CCCTGGTTTATGATGGATGTTGCCTAATGAG) for Tau minigenes (60), P1 and P55 (5Ј-GTCGCGGCCGCATCCTTTGAATTTCGCCAAG-3Ј) for Casp3 minigenes, and PT1 (5Ј-GTCGACGACACTTGCTCAAC-3Ј) and PT2 for Fas minigenes (22). Analysis and quantifications of spliced products were performed with an FPL-5000 Image Reader and ImageGauge software (Fuji Photo Film Inc.) (50).…”

Prediction of single‐nucleotide substitutions that result in exon skipping: identification of a splicing silencer inBRCA1exon 6

“…the first and the last three exon positions. Set 2 consisted of exon 12 inclusion levels measured after transfection of the wild-type CFTR minigene and its 42 mutated versions, as published previously [Pagani et al, 2005;Pagani et al, 2003] (Supplementary Table 5). …”

“…We also compared previously published exon inclusion data for 42 mutations in CFTR exon 12 that were determined ex vivo [Pagani et al, 2005;Pagani et al, 2003]. We found a significant correlation of exon 12 inclusion with the ESS/ESE ratio (r=-0.28, P=0.03) as well as for the total number of ESSs (-0.35), but not for ESEs or any of the remaining individual elements, except for trusted NI-ESSs that gave the highest correlation coefficient (-0.40, P=0.004).…”

A large-scale study of the random variability of a coding sequence: a study on the CFTR gene

“…The type of molecular variations most suitable for these studies are the single nucleotide substitutions in a coding sequence (cSNSs); (hereafter, when no ambiguity is possible, we shall also refer to them simply as substitutions) because the number and the consequences of cSNSs that may occur in a sequence of known length are known, not to mention that they include a perfectly defined 'control class' (the synonymous cSNSs) mainly consisting of neutral mutations (although it is known that some of them affect the splicing: for the possible molecular mechanisms see, eg, Pagani et al 1,2 ).…”