New substrates of DNA polymerases

Abstract

Bis-(2P P-deoxynucleoside) 5P P,5P P-tetraphosphates and bis-(2P P-deoxynucleoside) 5P P,5P P-triphosphates were shown to be a new type of substrate for several DNA polymerases of human, bacterial and viral origin. Their substrate properties depend both on their structure and on the nature of the enzyme. They are incorporated by both termini in correspondence with the template nucleotide program in the active center. The results obtained support the mechanism of their direct incorporation rather than prior hydrolysis to dNTP. The highest activity of these compounds was observed for HIV reverse transcriptase. The probable biological significance of the reaction is discussed.z 1999 Federation of European Biochemical Societies.

Chain-Terminating Dinucleoside Tetraphosphates Are Substrates for DNA Polymerization by Human Immunodeficiency Virus Type 1 Reverse Transcriptase with Increased Activity against Thymidine Analogue-Resistant Mutants

“…As can be seen in Fig. 5, increased incubation times led to an increased amount of the labeled product L32-ddGM- 33 P, indicating that Ap 4 ddG can serve as a dGTP analogue. Concomitant with the increase in L32-ddGM- 33 P was an increase in [␥-32 P]ATP and, importantly, no increase in PP i , indicating that ddGMP was incorporated into the primer terminus by HIV-1 RT directly from Ap 4 ddG.…”

“…After heat inactivation of the RT at 90°C for 5 min, 100 U of calf intestinal alkaline phosphatase (CIP) (New England Biolabs) was added, followed by incubation at 37°C for 2 h. One hundred units of CIP was added a second time, and incubation continued at 37°C for an additional 2 h, followed by heat inactivation at 90°C for 10 min. The CIP-treated products were loaded onto a 5-ml anion exchange column, HiTrap Q HP (Amersham Biosciences) preequilibrated with 10 mM triethylammonium bicarbonate buffer pH 8.5 (Sigma), and eluted with a gradient of triethylammonium bicarbonate buffer up to 1 M. Fractions containing 33 P-labeled dinucleoside polyphosphates were vacuum dried and resuspended in reaction buffer. The concentration of each compound was determined by incubation first with snake venom phosphodiesterase to cleave dinucleoside polyphosphates to free nucleotides, followed by spectrophotometric determination of the total concentration of nucleotide.…”

“…Each reaction was carried out in 1,000 l of reaction buffer (40 mM Na-HEPES, pH 7.5, 20 mM MgCl 2 , 60 mM KCl, 1 mM dithiothreitol, 2.5% glycerol) containing 160 g of bovine serum albumin (BSA) and 0.5 U of inorganic pyrophosphatase (Roche Applied Science). Templates and ddNTPs used were as follows: WL50 template (5Ј-GAG TGCTGAGGTCTTCATTCTGGTATCGTCTAGATGGAGAAAACTAGTA G-3Ј) with 3.2 mM ddATP and 10 Ci of [␣- 33 P]ddATP; WL50-33G template (5Ј-GAGTGCTGAGGTCTTCAGTCTGGTATCGTCTAGATGGAGAAAAC TAGTAG-3Ј) with 3.2 mM ddCTP and 10 Ci of [␣- 33 P]ddCTP; WL50-33C template (5Ј-GAGTGCTGAGGTCTTCACTCTGGTATCGTCTAGATGGA GAAAACTAGTAG-3Ј) with 3.2 mM ddGTP and 10 Ci of [␣-…”

ATP‐Releasing Nucleotides: Linking DNA Synthesis to Luciferase Signaling

“…Although dimeric polyphosphate-linked nucleotides are known in the literature, [13][14][15] the ATP-releasing chimeric nucleotides have not been studied previously. Tetraphosphatebridged deoxy-deoxy dinucleotides have been the subject of a report testing them as substrates for DNA polymerases.…”

“…Tetraphosphatebridged deoxy-deoxy dinucleotides have been the subject of a report testing them as substrates for DNA polymerases. 13 Tetraphosphate-linked ribo-ribo dimers have been studied more widely as enzyme inhibitors. 14,15 Despite these precedents, we know of no literature studies of chimeric ribo-deoxy tetraphosphate dinucleotides.…”