New observations on the utility of CA19-9 as a biomarker in Lewis negative patients with pancreatic cancer

Luo, Guopei; Fan, Zhichao; He, Cheng; Jin, Kaizhou; Guo, Meng; Yu, Lu; Yang, Chao; Fan, Kun; Huang, Qiuyi; Jiang, Long; Liu, Liang; Xu, Jin; Lu, Renquan; Ni, Quanxing; Warshaw, Andrew L.; Liu, Chen; Yu, Xianjun

doi:10.1016/j.pan.2018.08.003

Cited by 54 publications

(45 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the present study, 11.7% of patients with pancreatic cancer were Lewis negative. However, 24% of Lewis-negative pancreatic cancer patients had high secretion of CA19-9 (>37 U/ml), which was also been reported by previous studies (9,11,20). Therefore, the potential mechanisms should be explored.…”

Section: Discussionmentioning

confidence: 60%

“…Lewis genotyping. Lewis status was determined by Sanger sequencing using genomic DNA extracted from blood specimens or pancreatic cancer cell lines, as previously described (9,11,13). In order to detect variants in the Lewis gene: T59G, T202C, C314T, G508A and T1067A, the following primers were used for polymerase chain reaction amplification: 358F, GGGTGCAGC CAAGCCACAA and 358R, AGGTGGGAGGCGTGACTT AGG; P1F, ACTTGGAGCCACCCCCTAACTGCCA and 508R, CGGCCTCTCAGGTGAACCAAGCCGCT).…”

Section: Methodsmentioning

confidence: 99%

“…Carbohydrate antigen 19-9 (CA19-9), also called sialyl Lewis antigen A, is the most important biomarker for pancreatic cancer (6)(7)(8). The sensitivity in detecting pancreatic cancer is ~80% for CA19-9 (9). In the population, ~5-10% of individuals are Lewis antigen negative, with no or low secretion of CA19-9 (10).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Lewis antigen‑negative pancreatic cancer: An aggressive subgroup

et al. 2020

Self Cite

View full text Add to dashboard Cite

Carbohydrate antigen 19-9 (CA19-9) is the most important biomarker for pancreatic cancer. Approximately 5-10% of individuals are Lewis antigen negative with scarce secretion of CA19-9 and fucosylation deficiency. However, the characteristics of Lewis-negative pancreatic cancer are unidentified. Clinicopathological characteristics of 853 patients with pancreatic cancer were examined. Pancreatic cancer cell lines were sequenced for Lewis status. Morphological and molecular features of pancreatic cancer cells were compared. Orthotopic animal modes were established. Lewis-negative patients had poorer outcome (P<0.001), higher metastatic rate (P=0.004), lower CA19-9 expression (P<0.001) and higher MUC16 expression (P<0.001) than Lewis-positive patients. Lewis-negative cells (CaPan-1, MiaPaCa-2 and Panc-1) showed a shuttle shape with scarce pseudopods. Overall, Lewis-negative cells had higher proliferation rate, higher migration ability, lower fucosylation, lower CA19-9 expression and higher MUC16 expression than Lewis-positive cells (BxPC-3, SU8686, SW1990). Lewis-negative cell line MiaPaCa-2 corresponded to larger orthotopic tumor than Lewis-positive cells SU8686. Potential proteoglycans were identified in Lewis-positive cancer, including EGFR, HSPG2, ADAM17, GPC1, ITGA2, CD40, IL6ST and GGT1. Therefore, Lewis-negative pancreatic cancer is an aggressive subgroup with special clinical and molecular features.

show abstract

Section: Discussionmentioning

confidence: 60%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Lewis antigen‑negative pancreatic cancer: An aggressive subgroup

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Most reclassified PDAC cases were FUT3 heterozygotes (who have a low CA19-9 reference range) classified as having increased CA19-9 by SNP-stratified cut-off values but normal CA19-9 using the uniform diagnostic cut-off value. Setting uniformly high diagnostic cut-off values for biomarkers can improve diagnostic specificity, but at the expense of reduced diagnostic sensitivity, especially for small cancers 14,31 (in our study, a uniform 99% specificity cut-off value for CA19-9 yielded a sensitivity of 52.7%). We identified 4 genetic subgroups with respect to CA19-9; this 4-group classification improved the performance of CA19-9 as a diagnostic test compared with a 3-group classification suggested in recent studies.…”

Section: Discussionmentioning

confidence: 70%

Gene Variants That Affect Levels of Circulating Tumor Markers Increase Identification of Patients With Pancreatic Cancer

Abe

Koi

Kohi

et al. 2020

Clinical Gastroenterology and Hepatology

View full text Add to dashboard Cite

BACKGROUND & AIMS: Levels of carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9), and cancer antigen 125 (CA-125) in blood are used as markers to determine the response of patients with cancer to therapy, but are not used to identify patients with pancreatic cancer. METHODS: We obtained blood samples from 504 patients undergoing pancreatic surveillance from 2002 through 2018 who did not develop pancreatic cancer and measured levels of the tumor markers CA19-9, CEA, CA-125, and thrombospondin-2. Single-nucleotide polymorphisms (SNPs) in FUT3, FUT2, ABO, and GAL3ST2 that have been associated with levels of tumor markers were used to establish SNP-defined ranges for each tumor marker. We also tested the association between additional SNPs (in FUT6, MUC16, B3GNT3, FAM3B, and THBS2) with levels of tumor markers. To calculate the diagnostic specificity of each SNP-defined range, we assigned the patients under surveillance into training and validation sets. After determining the SNP-defined ranges, we determined the sensitivity of SNP-adjusted tests for the tumor markers, measuring levels in blood samples from 245 patients who underwent resection for pancreatic ductal adenocarcinoma (PDAC) from 2010 through 2017. RESULTS: A level of CA19-9 that identified patients with PDAC with 99% specificity had 52.7% sensitivity. When we set the cutoff levels of CA19-9 based on each SNP, the test for CA19-9 identified patients with PDAC with 60.8% sensitivity and 98.8% specificity. Among patients with FUT3 alleles that encode a functional protein, levels of CA19-9 greater than the SNP-determined cutoff values identified 66.4% of patients with PDAC, with 99.3% specificity. In the validation set, levels of CEA varied among patients with vs without SNP in FUT2, by blood group, and among smokers vs nonsmokers; levels of CA-125 varied among patients with vs without the SNP in GAL3ST2. The use of the SNPs to define the ranges of CEA and CA-125 did not significantly increase the diagnostic accuracy of the assays for these proteins. Combining data on levels of CA19-9 and CEA, CA19-9 and CA-125, or CA19-9 and thrombospondin-2 increased the sensitivity of detection of PDAC, but slightly reduced specificity. CONCLUSIONS: Including information on SNPs associated with levels of CA19-9, CEA, and CA-125 can improve the diagnostic accuracy of assays for these tumor markers in the identification of patients with PDAC. Clinicaltrials.gov no: NCT02000089.

show abstract

“…CA19-9 is a sialylated Lewis blood-group antigen, whose levels depends on the Lewis phenotype. Lewis negative individuals, accounting for 5-10% of the population, have low even absent secretion of CA19-9 even when they have malignant tumors [7,8]. A CA19-9 level of 5U/mL has been suggested as the threshold value for Lewis (+) and Lewis (-) population when Lewis genotyping unavailable [8,9].…”

Section: Introductionmentioning

confidence: 99%

The Prognostic Value of the CA19-9/TBIL Ratio in Patients With Biliary Tract Cancers (BTCs): A Retrospective Study

Xiao

Wang

Hong

et al. 2020

Preprint

View full text Add to dashboard Cite

Introduction: Incidence of biliary tract cancers (BTCs) in China is high, and surgery is the only curative option. Preoperative CA19-9 has been identified as a predictor for survival in patients with resectable BTCs, but more potential predictors need to be studied. This retrospective study aimed to establish the prognostic significance of CA19-9/TBIL ratio (CTR) in patients with BTCs.Methods: A retrospective analysis was performed in patients who diagnosed with BTCs and received surgical resection between 2013 and 2018 at PUMCH. Demographic and clinical parameters were collected. Preoperative CA19-9 and CTR were classified as elevated (> 58.6 and > 0.83) according to the receiver operating characteristics (ROC) analysis. Demographic and clinical parameters were compared between the groups using Student’s t-test, chi-square, or Fisher’s exact test. Survival analysis was performed by the Kaplan-Meier methods and the relationship between variables and survival was assessed by the log-rank test. Cox regression analysis was conducted to identify potential risk factors for overall survival.Results: In total 109 participants were involved in the final analysis. The overall survival rate was 18.0% at 5 years, with a median survival duration of 1.58 years. The Kaplan-Meier analysis indicated that higher CTR was associated with shorter OS (15 vs. 50, p < 0.01). Univariate survival analysis identified TNM staging, CA19-9, and CTR as statistically significant prognostic factors. In a multiple COX analysis, only CTR was proved as a significantly independent prognostic factor.Conclusion: CTR acts as an independent prognostic predictor for patients with biliary tract cancer.

show abstract

New observations on the utility of CA19-9 as a biomarker in Lewis negative patients with pancreatic cancer

Cited by 54 publications

References 27 publications

Lewis antigen‑negative pancreatic cancer: An aggressive subgroup

Lewis antigen‑negative pancreatic cancer: An aggressive subgroup

Gene Variants That Affect Levels of Circulating Tumor Markers Increase Identification of Patients With Pancreatic Cancer

The Prognostic Value of the CA19-9/TBIL Ratio in Patients With Biliary Tract Cancers (BTCs): A Retrospective Study

Contact Info

Product

Resources

About