New genes involved in the Bacterial Chondronecrosis with Osteomyelitis in commercial broilers

Petry, Bruna; Savoldi, Igor Ricardo; Ibelli, A. M. G.; Paludo, E.; Peixoto, J. de O.; Jaenisch, F. R. F.; Cucco, Diego de Córdova; Ledur, Mônica Corrêa

doi:10.1016/j.livsci.2017.12.003

Cited by 12 publications

(9 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, this gene was not grouped in any BP using DAVID. In this study, Angiopoietin-like 5 ( ANGPTL5 ) was one of the top 10 downregulated genes (Table 1) and Petry et al [32] have confirmed the downregulation of ANGPTL5 in FHS-affected broilers by qPCR. Angiopoietin-like proteins (ANGPTLs) are a family of proteins structurally similar to the angiopoietins, with functional roles in lipid metabolism, glucose metabolism, inflammation and hematopoiesis [39].…”

Section: Discussionsupporting

confidence: 63%

“…Durairaj et al [15] consider FHS as a metabolic skeletal problem in fast-growing chickens and observed elevation in blood lipid levels in broilers with FHS, suggesting that elevated lipid levels may be a risk factor for femoral head problems in chickens. Here, the ADIPOQ was downregulated in the femur of FHS-affected broilers and its expression profile was confirmed by qPCR [32]. According to DAVID results, ADIPOQ participates in 107 out of 226 BP mapped in this case-control study (Additional file 3), including bone development, cell adhesion, immune response and apoptosis, except homeostasis.…”

Section: Discussionmentioning

confidence: 63%

“…CHST1 differential expression pattern between health and FHS-affected group was also confirmed by qPCR (Table 2). Moreover, using the same experimental population, Petry et al [32] found that Adiponectin ( ADIPOQ ), Paired related Homeobox 1 ( PRRX1 ), ABI family member 3 NESH binding protein P ( ABI3B ) and COL8A1 genes were also downregulated in FHS-affected group by qPCR, confirming their involvement with ECM, cell adhesion and bone formation.…”

Section: Discussionmentioning

confidence: 94%

See 2 more Smart Citations

Proximal femoral head transcriptome reveals novel candidate genes related to epiphysiolysis in broiler chickens

et al. 2019

Self Cite

View full text Add to dashboard Cite

BackgroundThe proximal femoral head separation (FHS) or epiphysiolysis is a prevalent disorder affecting the chicken femur epiphysis, being considered a risk factor to infection which can cause bacterial chondronecrosis with osteomyelitis in broilers. To identify the genetic mechanisms involved in epiphysiolysis, differentially expressed (DE) genes in the femur of normal and FHS-affected broilers were identified using RNA-Seq technology. Femoral growth plate (GP) samples from 35-day-old commercial male broilers were collected from 4 healthy and 4 FHS-affected broilers. Sequencing was performed using an Illumina paired-end protocol. Differentially expressed genes were obtained using the edgeR package based on the False Discovery Rate (FDR < 0.05).ResultsApproximately 16 million reads/sample were generated with 2 × 100 bp paired-end reads. After data quality control, approximately 12 million reads/sample were mapped to the reference chicken genome (Galgal5). A total of 12,645 genes were expressed in the femur GP. Out of those, 314 were DE between groups, being 154 upregulated and 160 downregulated in FHS-affected broilers. In the functional analyses, several biological processes (BP) were overrepresented. Among them, those related to cell adhesion, extracellular matrix (ECM), bone development, blood circulation and lipid metabolism, which are more related to chicken growth, are possibly involved with the onset of FHS. On the other hand, BP associated to apoptosis or cell death and immune response, which were also found in our study, could be related to the consequence of the FHS.ConclusionsGenes with potential role in the epiphysiolysis were identified through the femur head transcriptome analysis, providing a better understanding of the mechanisms that regulate bone development in fast-growing chickens. In this study, we highlighted the importance of cell adhesion and extracellular matrix related genes in triggering FHS. Furthermore, we have shown new insights on the involvement of lipidemia and immune response/inflammation with FHS in broilers. Understanding the changes in the GP transcriptome might support breeding strategies to address poultry robustness and to obtain more resilient broilers.

show abstract

Section: Discussionsupporting

confidence: 63%

Section: Discussionmentioning

confidence: 63%

Section: Discussionmentioning

confidence: 94%

See 1 more Smart Citation

Proximal femoral head transcriptome reveals novel candidate genes related to epiphysiolysis in broiler chickens

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…Another study by the same authors found standard broiler crosses that grew rapidly at an early age developed higher incidences of BCO compared to crosses that grew more slowly (Wideman et al 2013). A more recent study by Petry et al (2018) identified 10 differentially expressed genes between normal and BCO-affected broilers and concluded that these genes are strong candidates for the development of BCO.…”

Section: Musculoskeletal Disordersmentioning

confidence: 97%

Genetic selection of broilers and welfare consequences: a review

Hartcher

Lum²

2019

World's Poultry Science Journal

View full text Add to dashboard Cite

The genetic selection of broilers over the past 60 years has focused narrowly and intensely on production traits, namely growth rate and feed efficiency. This has led to significant welfare problems in birds grown for meat, including leg disorders, cardiovascular diseases, and resulting high mortality rates, while the breeder birds are subjected to severe feed restriction. Bone problems such as bacterial chondronecrosis and tibia dyschondroplasia are prevalent, and recent studies have reported the prevalence of birds with moderate to severe gait impairment to be between 5.5 and 48.8%. Worldwide, over 66 billion broilers are slaughtered annually. This huge scale of meat chicken production means that welfare problems are widespread and are likely to increase in severity due to the increasing global human population, increasing demand for meat, and a continued focus on efficiency of production in the agricultural sector. The commercial broiler industry therefore represents some of the most serious animal welfare issues in agriculture. There is an urgent need to address these problems by making welfare traits high priorities in breeding programmes and integrating these with other breeding goals. Many studies recommend the use of slower-growing breeds that do not have the same welfare problems. Addressing these welfare issues is essential to improve bird welfare and for social acceptability and sustainability of the broiler industry worldwide.

show abstract

“…R: GTCAGAGTCACCTGGGTCAA 1 Paludo et al [34], 2 Nascimento et al [35], 3 Petry et al [36], 4 Marciano et al [37].…”

Section: F: Atgattcggcaaggcaaagc Ensgalg00000029897mentioning

confidence: 99%

Reference genes for proximal femoral epiphysiolysis expression studies in broilers cartilage

et al. 2020

Self Cite

View full text Add to dashboard Cite

The use of reference genes is required for relative quantification in gene expression analysis and the stability of these genes can be variable depending on the experimental design. Therefore, it is indispensable to test the reliability of endogenous genes previously to their use. This study evaluated nine candidate reference genes to select the most stable genes to be used as reference in gene expression studies with the femoral cartilage of normal and epiphysiolysis-affected broilers. The femur articular cartilage of 29 male broilers with 35 days of age was collected, frozen and further submitted to RNA extraction and quantitative PCR (qPCR) analysis. The candidate reference genes evaluated were GAPDH, HMBS, HPRT1, MRPS27, MRPS30, RPL30, RPL4, RPL5, and RPLP1. For the gene stability evaluation, three software were used: GeNorm, BestKeeper and NormFinder, and a global ranking was generated using the function RankAggreg. In this study, the RPLP1 and RPL5 were the most reliable endogenous genes being recommended for expression studies with femur cartilage in broilers with epiphysiolysis and possible other femur anomalies.

show abstract

New genes involved in the Bacterial Chondronecrosis with Osteomyelitis in commercial broilers

Cited by 12 publications

References 50 publications

Proximal femoral head transcriptome reveals novel candidate genes related to epiphysiolysis in broiler chickens

Proximal femoral head transcriptome reveals novel candidate genes related to epiphysiolysis in broiler chickens

Genetic selection of broilers and welfare consequences: a review

Reference genes for proximal femoral epiphysiolysis expression studies in broilers cartilage

Contact Info

Product

Resources

About