New Enzyme-Linked Immunosorbent Assay for Detection of Antibodies against Hepatitis Delta Virus Using a Hepatitis Delta Antigen Derived from a Taiwanese Clone and Comparison to the Abbott Radioimmunoassay

Kuo, Yung-Bin; Chao, Mei; Lee, Yi‐Hsuan; Yeh, Chau‐Ting; Chan, Err–Cheng

doi:10.1128/cvi.05687-11

Cited by 6 publications

(9 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The fact that not all anti-HDV-positive patients had detectable HDV-RNA could be related to the low specificity of the anti-HDV assay, leading to false-positive results, a finding reported by previous studies. 24,25 In addition, some patients spontaneously lose HDV-RNA due to the natural course of the disease, as shown in the present study. person-months.…”

Section: Discussionsupporting

confidence: 74%

“…Patients with detectable HDV‐RNA had liver cirrhosis more often than those in whom it was undetectable, confirming the severity of chronic hepatitis delta infection. The fact that not all anti‐HDV‐positive patients had detectable HDV‐RNA could be related to the low specificity of the anti‐HDV assay, leading to false‐positive results, a finding reported by previous studies . In addition, some patients spontaneously lose HDV‐RNA due to the natural course of the disease, as shown in the present study.…”

Section: Discussionsupporting

confidence: 61%

See 1 more Smart Citation

Long‐term clinical outcomes in patients with chronic hepatitis delta: the role of persistent viraemia

Palom

Rodríguez‐Tajes

Navascués

et al. 2019

Aliment Pharmacol Ther

View full text Add to dashboard Cite

Summary Background Chronic hepatitis delta is a severe liver disease with rapid progression to cirrhosis. The impact of hepatitis delta virus (HDV)‐RNA on disease progression and interferon treatment in a real‐world cohort has been barely explored. Aim To assess the development of clinical events in a cohort of chronic hepatitis delta patients according to the presence or absence of HDV‐RNA Methods Multicentre study at four academic hospitals in Spain included anti‐HDV‐positive patients with compensated liver disease with a follow‐up ≥12 months. Results Among 2888 HBsAg‐positive subjects, 151 (5.2%) tested positive for anti‐HDV, and 118 were included (58% men; median age, 49 years; 73% detectable HDV‐RNA and 30% cirrhosis, most often in subjects with HDV‐RNA). After a median follow‐up of 8 years, subjects with initially detectable HDV‐RNA were more prone to developing cirrhosis (31% vs 0%, P = .002) and/or liver decompensation (28% vs 3%, P = .019). Mortality rate was 0.44 per 1000 person‐months. The probability of a clinical event was 6%, 25%, and 80% according to initial baseline‐event‐anticipation score. HDV‐RNA became undetectable in 21 (24%) subjects either due to interferon or spontaneously (48% vs 52%, P = .29). Liver decompensation was reduced in interferon‐treated patients (13% vs 38%, P = .026). Conclusions Subjects with persistently positive HDV‐RNA had a worse prognosis in terms of clinical events. Baseline‐event‐anticipation score is useful in predicting the risk of developing liver decompensation and hepatocellular carcinoma. Interferon was beneficial in reducing liver decompensation, even in the absence of virological response.

show abstract

Section: Discussionsupporting

confidence: 74%

Section: Discussionsupporting

confidence: 61%

Long‐term clinical outcomes in patients with chronic hepatitis delta: the role of persistent viraemia

Palom

Rodríguez‐Tajes

Navascués

et al. 2019

Aliment Pharmacol Ther

View full text Add to dashboard Cite

show abstract

“…In this method a recombinant 127 amino acid HDAg, was used as the specific target. The sensitivity and specificity of their model were 97.3 and 100% respectively in comparison with RIA ( 16 ). Ansaldi and colleagues have also evaluated a model of ELISA for simultaneous detection of anti-HCV antibody and HCV core antigen ( 17 ).…”

Section: Resultsmentioning

confidence: 99%

Classical and Modern Approaches Used for Viral Hepatitis Diagnosis

2014

View full text Add to dashboard Cite

Context:Viral hepatitis diagnosis is an important issue in the treatment procedure of this infection. Late diagnosis and delayed treatment of viral hepatitis infections can lead to irreversible liver damages and occurrence of liver cirrhosis and hepatocellular carcinoma. A variety of laboratory methods including old and new technologies are being applied to detect hepatitis viruses. Here we have tried to review, categorize, compare and illustrate the classical and modern approaches used for diagnosis of viral hepatitis.Evidence Acquisition:In order to achieve a comprehensive aspect in viral hepatitis detection methods, an extensive search using related keywords was done in major medical library and data were collected, categorized and summarized in different sections.Results:Analyzing of collected data resulted in the wrapping up the hepatitis virus detection methods in separate sections including 1) immunological methods such as enzyme immunoassay (EIA), radio-immunoassay (RIA) immuno-chromatographic assay (ICA), and immuno-chemiluminescence 2) molecular approaches including non-amplification and amplification based methods, and finally 3) advanced biosensors such as mass-sensitive, electrical, electrochemical and optical based biosensors and also new generation of detection methods.Conclusions:Detection procedures in the clinical laboratories possess a large diversity; each has their individual advantages and facilities' differences.

show abstract

“…Hepatitis E virus (HEV) RNA was detected by in‐house RT‐PCR assay described previously [Hsieh et al, ]. HDV RNA was also detected by in‐house RT‐PCR assay [Kuo et al, ]. The primers used were 5′‐CATGGTCCCAGCCTCCTCGCTGGC‐3′ (nt.…”

Section: Methodsmentioning

confidence: 99%

Detection of serum anti-NV-F antibodies in the convalescent phase of severe hepatitis in patients positive for tissue NV-F antigen and novel virus-like particles

Yeh

Tsao

2015

J. Med. Virol.

Self Cite

View full text Add to dashboard Cite

Previously, a non-human DNA fragment named NV-F was isolated from a patient with non-A-E fulminant hepatitis. This sequence encoded an incomplete open reading frame (the NV-F antigen). In this study, we developed a western blot assay to detect serum anti-NV-F antibodies. Serum samples from 347 patients with severe hepatitis (ALT > fivefold ULN) were analyzed to understand the prevalence and distribution of the NV-F associated virus (HnFV) infection. Of these patients, acute HnFV infection was diagnosed (by positive serum NV-F DNA) in 34 patients (9.8%). However, none of these 34 serum samples were positive for serum anti-NV-F antibodies. In the remaining patients negative for serum NV-F DNA, 62 (17.9%) were positive for serum anti-NV-F antibodies. Liver biopsy samples from 35 severe hepatitis patients were submitted for immunohistochemistry and electron microscopy examination. Of them, seven were positive for hepatic NV-F antigen expression. Electron microscopy identified a novel virus-like particle in all of the seven NV-F antigen-positive liver tissues but not in the remaining 28 NV-F antigen-negative liver tissues. Longitudinal serum sample analysis revealed transient positivity of serum NV-F DNA in three of the seven patients during the clinical courses. Seroconversion of anti-NV-F antibody from negative to positive was found in four of the seven patients and all positive anti-NV-F antibodies were detected in the convalescent phases. In conclusion, in patients with severe hepatitis, a novel hepatotropic virus, temporarily named HnFV, was found in liver tissues expressing the NV-F antigen. Serum anti-NV-F antibodies were detected in the convalescent serum samples.

show abstract

New Enzyme-Linked Immunosorbent Assay for Detection of Antibodies against Hepatitis Delta Virus Using a Hepatitis Delta Antigen Derived from a Taiwanese Clone and Comparison to the Abbott Radioimmunoassay

Cited by 6 publications

References 23 publications

Long‐term clinical outcomes in patients with chronic hepatitis delta: the role of persistent viraemia

Long‐term clinical outcomes in patients with chronic hepatitis delta: the role of persistent viraemia

Classical and Modern Approaches Used for Viral Hepatitis Diagnosis

Detection of serum anti-NV-F antibodies in the convalescent phase of severe hepatitis in patients positive for tissue NV-F antigen and novel virus-like particles

Contact Info

Product

Resources

About