Neuronal UCP1 expression suggests a mechanism for local thermogenesis during hibernation

Abstract

Hibernating mammals possess a unique ability to reduce their body temperature to ambient levels, which can be as low as −2.9°C, by active down-regulation of metabolism. Despite such a depressed physiologic phenotype, hibernators still maintain activity in their nervous systems, as evidenced by their continued sensitivity to auditory, tactile, and thermal stimulation. The molecular mechanisms that underlie this adaptation remain unknown. We report, using differential transcriptomics alongside immunohistologic and biochemical analyses, that neurons from thirteen-lined ground squirrels (Ictidomys tridecemlineatus) express mitochondrial uncoupling protein 1 (UCP1). The expression changes seasonally, with higher expression during hibernation compared with the summer active state. Functional and pharmacologic analyses show that squirrel UCP1 acts as the typical thermogenic protein in vitro. Accordingly, we found that mitochondria isolated from torpid squirrel brain show a high level of palmitate-induced uncoupling. Furthermore, torpid squirrels during the hibernation season keep their brain temperature significantly elevated above ambient temperature and that of the rest of the body, including brown adipose tissue. Together, our findings suggest that UCP1 contributes to local thermogenesis in the squirrel brain, and thus supports nervous tissue function at low body temperature during hibernation.T hirteen-lined ground squirrels (Ictidomys tridecemlineatus) are obligatory hibernating mammals. They are found across a wide range of latitudes, from southern Canada to the Gulf of Mexico. In northern habitats with long winters and limited food resources, ground squirrels breed only once a year, in late spring, and then hibernate in underground burrows from October to April. Hibernation consists of cycling between bouts of torpor and brief interbout arousal periods, each usually lasting less than 24 h (1, 2).During the long hibernation season, torpid animals undergo dramatic perturbations, including reduction in heart, respiratory, and overall metabolic rates, as well as decreases in core body temperature from 37°C to just above ambient temperature (often as low as 1-5°C) (2). Despite such a depressed physiologic phenotype, torpid animals remain sensitive to their environment (3). For example, during extreme winters, when ambient burrow temperatures reach the freezing point of water, most hibernating mammals increase metabolic activity and warm up as a safety precaution to prevent freezing (4). Similarly, arousal can be triggered by sound, touch, or a sudden increase in ambient temperature (3, 5). Thus, hibernating animals maintain activity in their peripheral and central nervous systems. Indeed, physiologic experiments conducted on nerve fibers isolated from torpid hamsters and squirrels demonstrated the ability to generate action potentials at temperatures prohibitively low for their nonhibernating relatives (i.e., rats, mice) (6-8).Deeply hibernating animals can keep their brain temperatures elevated above ambient by seve...

Protein Deimination Signatures in Plasma and Plasma-EVs and Protein Deimination in the Brain Vasculature in a Rat Model of Pre-Motor Parkinson’s Disease

“…Alteration in mitochondrial complexes, restricting energy output, are related to sepsis as well as PD [57] and implicated in other neurodegenerative disease such as AD, as well as being associated with diabetes [60]. Interestingly, thermogenesis is also linked to CNS activity in hibernating animals [61,62]. Deimination in thermogenesis pathways has not been identified before and provides a novel insight into putative regulation via such post-translational modifications.…”

Increased Expression of Beige/Brown Adipose Markers from Host and Breast Cancer Cells Influence Xenograft Formation in Mice

“…Notably, this increase of beige and brown adipose markers from the tumor cells as well as the host was independent of the site of implantation of the tumor cells. Although expression of UCP1 has been mainly reported in beige/brown adipose tissues, its expression has also been detected in macrophages (39), pancreas (40) and nervous tissues of torpid animals (41). …”

Somatosensory Neurons Enter a State of Altered Excitability during Hibernation

“…qPCR calibrations and normalizations were performed using the Illumina Eco System machine in accordance with the manufacturer’s instructions. Each reaction was run in triplicate, using the HPRT1 gene as the reference [34]. Amplification primer pairs (5 0 –3 0 ) were Scn9a: ATCCCAGCCTCACAGTGACAG; CACTCAGAG GAACTCAATCGGC (product size 133 bp); Scn10a: CTGCAGCAAGTCGGGAGGTA; TGCAGGAACCTGAGGAGCAG (product size 109 bp).…”