Nest box exploration may stimulate breeding physiology and alter mRNA expression in the medial preoptic area of female European starlings

Abstract

Environmental resources are proposed to fine-tune the timing of breeding, yet how they may do so remains unclear. In female European starlings (), nest cavities are limited resources that are necessary for breeding. Females that explore nest cavities, compared with those that do not, readily perform sexually motivated behaviors. We assigned female starlings to aviaries with: (1) no nest boxes, (2) nest boxes, or (3) nest boxes, plants, flowing water, insects and berries to test the hypothesis that environmental resources alter neural systems to stimulate mating behavior. Compared with other females, females that were housed with and explored nest boxes had higher estradiol, higher preproenkephalin (PENK) mRNA and lower levels of D1 and D2 dopamine receptor mRNA in the medial preoptic area (mPOA); a region in which opioids and dopamine modify female sexual behaviors and sexual motivation. Additionally, in the mPOA, PENK and tyrosine hydroxylase mRNA positively predicted, whereas estrogen receptor beta mRNA negatively predicted, nest box exploration. In the ventromedial hypothalamus (a region in which estradiol acts to stimulate sexual behavior), estrogen receptor alpha mRNA was highest in females that had access to but did not explore nest cavities. It is likely that seasonal increases in estradiol modify mRNA in the mPOA to facilitate nest cavity exploration. It is also possible that nest cavity exploration further alters gene expression in the mPOA, functioning to coordinate mating with resource availability. Thus, nest cavity exploration may be a form of self-stimulation that alters neural systems to fine-tune sexual behavior.

Complex patterns of dopamine‐related gene expression in the ventral tegmental area of male zebra finches relate to dyadic interactions with long‐term female partners

“…Quantitative real time PCR (qPCR) was run to verify RNA‐seq results for genes of interest (TH, SLC6A2 and DDC), selected based on WGCNA results below, and two reference genes (PGK1 and PPIA). qPCR was run on cDNA synthesized from the same RNA used for the RNA‐seq using methods identical to those reported in our past research, including the same reference genes using the following primers: TH forward—GCCATGCTGAACCTCTTCTT, reverse—GATGGTGGCACTTGTCCAAT; SLC6A2 forward—TGTGGAAAGGCGTGAAGACT, reverse—TAGTCAGCAAAGCATCCCTGT; DDC forward—ACAGATTATCGGCACTGGCA, reverse—GGAAGCAGACCAGTCCCAAA.…”

Effects of Dark Brooder Rearing and Age on Hypothalamic Vasotocin and Feather Corticosterone Levels in Laying Hens

“…The agerelated expression of AVT may be related to sexual development and lay onset in the chickens in the present study. The MPO has been linked to nest-exploration behavior in starlings, with higher estradiol, higher preproenkephalin (PENK) mRNA and lower levels of D1 and D2 dopamine receptor mRNA in the MPO in female starlings which had explored a nest than those which had not (50). Onset of laying in Isa Warren hens is generally around 19 weeks of age, with peak production at 26 weeks of age.…”

Why Do Birds Flock? A Role for Opioids in the Reinforcement of Gregarious Social Interactions

“…Treatment of castrated male starlings with testosterone alters opioid markers in a complex fashion, resulting in increased mu-opioid receptor and preproenkephalin mRNA and steroid-related mRNA (i.e., androgen receptors and aromatase) in mPOA relative to controls, but also reducing numbers of immunolabeled mu opioid receptor cell bodies in the rostral portion of mPOA (Figure 7) (Spool et al, 2016, 2018b), a subregion thought to modulate appetitive sexual behavior (Riters and Ball, 1999; Balthazart and Ball, 2007). In female starlings, individuals with elevated concentrations of estradiol tend to have higher preproenkephalin mRNA in mPOA relative to females with low concentrations of estradiol (Spool et al, 2018a). Additionally, in free-living songbirds mu opioid receptor mRNA in the mPOA changes seasonally, peaking during the breeding season (Woods et al, 2010).…”