Natural killer gene complex (Nkc) allelic variability in inbred mice: evidence for Nkc haplotypes

Brown, Michael G.; Scalzo, Anthony A.; Stone, Laurie R.; Clark, Patricia; Du, Ying; Palanca, Ben Julian A.; Yokoyama, Wayne M.

doi:10.1007/s002510100365

Cited by 49 publications

(47 citation statements)

References 1 publication

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Cmv1-r /Uwa mice, as the NKC is highly polymorphic between inbred mouse strains (11). HSV-1 strain differences cannot account for the discrepant mortality results, since the LD 50 values for 129 mice inoculated on the cornea with HSV-1(17ϩ) (used in our studies) or HSV-1 SC16 (used in studies by Pereira et al) were similar, i.e., 330 or 795 PFU, respectively.…”

Section: Discussionmentioning

confidence: 82%

A Locus on Mouse Chromosome 6 That Determines Resistance to Herpes Simplex Virus Also Influences Reactivation, While an Unlinked Locus Augments Resistance of Female Mice

Lundberg

Welander

Openshaw

et al. 2003

J Virol

View full text Add to dashboard Cite

During studies to determine a role for tumor necrosis factor (TNF) in herpes simplex virus type 1 (HSV-1) infection using TNF receptor null mutant mice, we discovered a genetic locus, closely linked to the TNF p55 receptor (Tnfrsf1a) gene on mouse chromosome 6 (c6), that determines resistance or susceptibility to HSV-1. We named this locus the herpes resistance locus, Hrl, and showed that it also mediates resistance to HSV-2. Hrl has at least two alleles, Hrl r , expressed by resistant strains like C57BL/6 (B6), and Hrl s , expressed by susceptible strains like 129S6 (129) and BALB/c. Although Hrl is inherited as an autosomal dominant gene, resistance to HSV-1 is strongly sex biased such that female mice are significantly more resistant than male mice. Analysis of backcrosses between resistant B6 and susceptible 129 mice revealed that a second locus, tentatively named the sex modifier locus, Sml, functions to augment resistance of female mice. Besides determining resistance, Hrl is one of several genes involved in the control of HSV-1 replication in the eye and ganglion. Remarkably, Hrl also affects reactivation of HSV-1, possibly by interaction with some unknown gene(s). We showed that Hrl is distinct from Cmv1, the gene that determines resistance to murine cytomegalovirus, which is encoded in the major NK cell complex just distal of p55 on c6. Hrl has been mapped to a roughly 5-centimorgan interval on c6, and current efforts are focused on obtaining a high-resolution map for Hrl.

show abstract

Section: Discussionmentioning

confidence: 82%

A Locus on Mouse Chromosome 6 That Determines Resistance to Herpes Simplex Virus Also Influences Reactivation, While an Unlinked Locus Augments Resistance of Female Mice

Lundberg

Welander

Openshaw

et al. 2003

J Virol

View full text Add to dashboard Cite

show abstract

“…C57BL/6 mice were obtained from the National Cancer Institute. Early in the backcross process, progeny were selected for the C57BL/6 NK gene complex alleles by PCR so that the NK cells from these mice were genotypically C57BL/6 (20). Primers for NKRP1a were: forward, TGCTTGACTCAAATTCATGAGG; reverse, ATTTTACTCGA CACCAGGTTGA, B6 allele 110 nt, 129 allele 133 nt.…”

Section: Production Of Nklam-deficient Micementioning

confidence: 99%

Impaired NK Cytolytic Activity and Enhanced Tumor Growth in NK Lytic-Associated Molecule-Deficient Mice

Hoover

Gullickson

Kornbluth

2009

The Journal of Immunology

View full text Add to dashboard Cite

NK lytic-associated molecule (NKLAM) is a protein involved in the cytolytic function of NK cells. It is weakly expressed in resting NK cells but upon target cell stimulation or after incubation with cytokines that enhance NK killing, NKLAM mRNA levels increase and protein is synthesized and is targeted to cytoplasmic granule membranes. We have previously shown that NKLAM plays a role in perforin/granzyme-mediated cytolysis in vitro. To further investigate the function of NKLAM in NK cell-mediated cytotoxicity, we generated, by gene targeting, NKLAM-deficient mice. These mice have normal numbers of NK cells and other lymphoid populations in the spleen. They also have no alterations in NK maturation or NK receptor repertoire. NK cells from NKLAM-deficient and WT mice have comparable amounts of perforin, granzyme B, and lysosomal membrane-associated protein 1 (CD107a) in their cytotoxic granules and comparable levels of granule exocytosis are induced by PMA and calcium ionophore A23187. However, NKLAM-deficient NK cells display significantly less NK cytotoxic activity in vitro than WT NK cells. They also secrete less IFN-γ upon target cell stimulation, In addition, NKLAM-deficient mice exhibit greater numbers of pulmonary metastases after i.v. injection with B16 melanoma cells. These studies indicate that NKLAM-deficient mice have diminished capacity to control tumor metastases and support the role for NKLAM in NK function both in vitro and in vivo.

show abstract

“…We reasoned that strains containing mAb 3D10-binding NK cells should display Cmv1 r -type resistance after MCMV infection because mAb 3D10 can block MCMV resistance in B6 mice. NZW and NZB mice were further studied because of their genealogical relationship (27) and for the similarity of their proximal NKC haplotypes spanning the Nkrp1-Ly49 gene clusters without the distal NKC haplotype (includes Mrc) homology (25). Both strains contain NK1.1 ϩ splenocytes (28) that also bound mAb 3D10 (see Fig.…”

Section: Nk Cell Receptor Expression and MCMV Immunity In Nz Micementioning

confidence: 99%

Cmv1-Independent Antiviral Role of NK Cells Revealed in Murine Cytomegalovirus-Infected New Zealand White Mice

Rodriguez¹,

Sabastian

Clark

et al. 2004

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

Ly49H+ NK cells play a critical role in innate antiviral immune responses to murine CMV (MCMV). Ly49Hb6 recognition of MCMV-encoded m157 on infected cells activates natural killing required for host resistance. We show that mAb 3D10 (anti-Ly49H) recognizes comparable subsets of NK cells from New Zealand White (NZW), New Zealand Black (NZB), and C57BL/6 spleens. However, virus levels in the spleens of MCMV-infected NZW and NZB mice differed greatly. We found that MCMV replication in infected NZW spleens was limited through NK cells. Alternately, NZB mice were profoundly susceptible to MCMV infection. Although 3D10 mAb injections given before infection interfere with Cmv1-type resistance in C57BL/6 mice, similar mAb injections did not affect NZW resistance, likely because NZW NK cell receptors did not bind MCMV-encoded m157. Instead, anti-MCMV host defenses in hybrid NZ offspring were associated with multiple chromosome locations including several putative quantitative trait loci that did not overlap with H-2 or NK gene complex loci. This study revealed a novel pathway used by NK cells to defend against MCMV infection. Thus, the importance of Ly49H in MCMV infection may be shaped by other additional background genes.

show abstract

Natural killer gene complex (Nkc) allelic variability in inbred mice: evidence for Nkc haplotypes

Cited by 49 publications

References 1 publication

A Locus on Mouse Chromosome 6 That Determines Resistance to Herpes Simplex Virus Also Influences Reactivation, While an Unlinked Locus Augments Resistance of Female Mice

A Locus on Mouse Chromosome 6 That Determines Resistance to Herpes Simplex Virus Also Influences Reactivation, While an Unlinked Locus Augments Resistance of Female Mice

Impaired NK Cytolytic Activity and Enhanced Tumor Growth in NK Lytic-Associated Molecule-Deficient Mice

Cmv1-Independent Antiviral Role of NK Cells Revealed in Murine Cytomegalovirus-Infected New Zealand White Mice

Contact Info

Product

Resources

About