Nanobody-based magnetic chemiluminescence immunoassay for one-pot detection of ochratoxin A

Zuo, Hu; Wang, Xinyang; Li, Wentao; Chen, Zongfen; Liu, Ruonan; Yang, Han Na; Xia, Chunyan; Xie, Jinli; Sun, Tieqiang; Ning, Baoan

doi:10.1016/j.talanta.2023.124388

Cited by 12 publications

(6 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A linear relationship existed between the changed absorbance and logarithm concentration of OTA within the range of 20–500 μg L –1 (Figure c), and the linear equation was fitted as y = −2.98 log( c OTA /μg L –1 ) + 0.88 ( R 2 = 0.984). The limit of detection (LOD) was estimated to be 4.79 μg L –1 according to the equation LOD = 3 × σ/ S , where σ is the blank standard deviation, and S is the slope of the calibration curve. , Table S3 − summarizes the analytical performance of previously reported work on OTA identification. This work is not outstanding in terms of detection limit since riboswitch biosensor analytical methods are just in their infancy. , The aptamer domain sequence of the riboswitch is highly conserved, and the aptamer domain and expression platform domain reporter genes are relatively independent, which means that multiple signal output forms can be achieved by changing the type of reporter gene or various target detection by changing aptamer.…”

Section: Resultsmentioning

confidence: 99%

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

Dong,

Qi,

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the −17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

show abstract

Section: Resultsmentioning

confidence: 99%

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

Dong,

Qi,

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

show abstract

“…Kloeckera apiculata strains 3187, 3188, 3189, 3197, 3198, and 3200 can eliminate between 25 and 40% of OTA (0.006 µg/mL) over 20 days [292]. In addition, Zou et al [151] demonstrated that an employed UV-mutated Aspergillus niger (FS-UV-21) exhibited an impressive OTA degradation efficiency up to 89.4% under specific conditions, resulting in a substantial reduction of thein OTA cytotoxic effects of treated food. Finally, Fiori et al [293], tested the capacity of viable and nonviable yeast strains to adsorb OTA, demonstrating that strains of Candida friedrichii, C. intermedia, Lachancea thermotolerans, and Cyberlindnera jadinii within an 8-day period exhibited OTA adsorption percentages of 70, 73, 75%, and no significant adsorption, respectively, whether vital, and 72, 74, 84, and 82% after autoclaving, respectively.…”

Section: Microorganisms and Enzymesmentioning

confidence: 99%

Comprehensive Insights into Ochratoxin A: Occurrence, Analysis, and Control Strategies

Ben Miri,

Benabdallah,

Chentir

et al. 2024

Foods

View full text Add to dashboard Cite

Ochratoxin A (OTA) is a toxic mycotoxin produced by some mold species from genera Penicillium and Aspergillus. OTA has been detected in cereals, cereal-derived products, dried fruits, wine, grape juice, beer, tea, coffee, cocoa, nuts, spices, licorice, processed meat, cheese, and other foods. OTA can induce a wide range of health effects attributable to its toxicological properties, including teratogenicity, immunotoxicity, carcinogenicity, genotoxicity, neurotoxicity, and hepatotoxicity. OTA is not only toxic to humans but also harmful to livestock like cows, goats, and poultry. This is why the European Union and various countries regulate the maximum permitted levels of OTA in foods. This review intends to summarize all the main aspects concerning OTA, starting from the chemical structure and fungi that produce it, its presence in food, its toxicity, and methods of analysis, as well as control strategies, including both fungal development and methods of inactivation of the molecule. Finally, the review provides some ideas for future approaches aimed at reducing the OTA levels in foods.

show abstract

“…Among the Ab fragments, Nbs with the smallest antigen‐binding domain have demonstrated superior properties than natural Abs for the fabrication of immunosensors. This is benefited from their variety of fascinating characteristics which includes minimal size (a cylindrical shape with ∼2.5 nm in diameter and 4 nm in height), enhanced tolerance to extreme temperature or pH levels, higher loading density on the carriers, easier incorporation of additional functionality, and preparation of multivalent nanobodies (Zuo, Wang et al., 2023). Another leading advantage of Nbs is their higher tolerance to organic solvents, facilitating their applications in the determination of mycotoxins extracted or eluted with organic solvents.…”

Section: Recognition Elements (Ab and Aptamer) In Preparing Mycotoxin...mentioning

confidence: 99%

Magnetic nanoparticle‐based immunosensors and aptasensors for mycotoxin detection in foodstuffs: An update

Gao,

Zhou,

Zhang

et al. 2023

Comp Rev Food Sci Food Safe

View full text Add to dashboard Cite

Mycotoxin contamination of food crops is a global challenge due to their unpredictable occurrence and severe adverse health effects on humans. Therefore, it is of great importance to develop effective tools to prevent the accumulation of mycotoxins through the food chain. The use of magnetic nanoparticle (MNP)‐assisted biosensors for detecting mycotoxin in complex foodstuffs has garnered great interest due to the significantly enhanced sensitivity and accuracy. Within such a context, this review includes the fundamentals and recent advances (2020–2023) in the area of mycotoxin monitoring in food matrices using MNP‐based aptasensors and immunosensors. In this review, we start by providing a comprehensive introduction to the design of immunosensors (natural antibody or nanobody, random or site‐oriented immobilization) and aptasensors (techniques for aptamer selection, characterization, and truncation). Meanwhile, special attention is paid to the multifunctionalities of MNPs (recoverable adsorbent, versatile carrier, and signal indicator) in preparing mycotoxin‐specific biosensors. Further, the contribution of MNPs to the multiplexing determination of various mycotoxins is summarized. Finally, challenges and future perspectives for the practical applications of MNP‐assisted biosensors are also discussed. The progress and updates of MNP‐based biosensors shown in this review are expected to offer readers valuable insights about the design of MNP‐based tools for the effective detection of mycotoxins in practical applications.

show abstract

Nanobody-based magnetic chemiluminescence immunoassay for one-pot detection of ochratoxin A

Cited by 12 publications

References 54 publications

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

Comprehensive Insights into Ochratoxin A: Occurrence, Analysis, and Control Strategies

Magnetic nanoparticle‐based immunosensors and aptasensors for mycotoxin detection in foodstuffs: An update

Contact Info

Product

Resources

About